ID: 911797545

View in Genome Browser
Species Human (GRCh38)
Location 1:102092858-102092880
Sequence ATGATGAATTCCTCTTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911797545_911797549 26 Left 911797545 1:102092858-102092880 CCCTTTGAAGAGGAATTCATCAT No data
Right 911797549 1:102092907-102092929 ATCACCCAACCTTGATGAGCTGG No data
911797545_911797551 30 Left 911797545 1:102092858-102092880 CCCTTTGAAGAGGAATTCATCAT No data
Right 911797551 1:102092911-102092933 CCCAACCTTGATGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911797545 Original CRISPR ATGATGAATTCCTCTTCAAA GGG (reversed) Intergenic
No off target data available for this crispr