ID: 911797551

View in Genome Browser
Species Human (GRCh38)
Location 1:102092911-102092933
Sequence CCCAACCTTGATGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911797545_911797551 30 Left 911797545 1:102092858-102092880 CCCTTTGAAGAGGAATTCATCAT No data
Right 911797551 1:102092911-102092933 CCCAACCTTGATGAGCTGGAAGG No data
911797546_911797551 29 Left 911797546 1:102092859-102092881 CCTTTGAAGAGGAATTCATCATC No data
Right 911797551 1:102092911-102092933 CCCAACCTTGATGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911797551 Original CRISPR CCCAACCTTGATGAGCTGGA AGG Intergenic
No off target data available for this crispr