ID: 911797738

View in Genome Browser
Species Human (GRCh38)
Location 1:102095454-102095476
Sequence GGTGATGGGGCTATAGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911797738_911797745 4 Left 911797738 1:102095454-102095476 CCCATAACTATAGCCCCATCACC No data
Right 911797745 1:102095481-102095503 GTCTGTCTGTAGCCCCGTCATGG No data
911797738_911797746 5 Left 911797738 1:102095454-102095476 CCCATAACTATAGCCCCATCACC No data
Right 911797746 1:102095482-102095504 TCTGTCTGTAGCCCCGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911797738 Original CRISPR GGTGATGGGGCTATAGTTAT GGG (reversed) Intergenic
No off target data available for this crispr