ID: 911797746

View in Genome Browser
Species Human (GRCh38)
Location 1:102095482-102095504
Sequence TCTGTCTGTAGCCCCGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911797738_911797746 5 Left 911797738 1:102095454-102095476 CCCATAACTATAGCCCCATCACC No data
Right 911797746 1:102095482-102095504 TCTGTCTGTAGCCCCGTCATGGG No data
911797741_911797746 -8 Left 911797741 1:102095467-102095489 CCCCATCACCAGGTGTCTGTCTG No data
Right 911797746 1:102095482-102095504 TCTGTCTGTAGCCCCGTCATGGG No data
911797742_911797746 -9 Left 911797742 1:102095468-102095490 CCCATCACCAGGTGTCTGTCTGT No data
Right 911797746 1:102095482-102095504 TCTGTCTGTAGCCCCGTCATGGG No data
911797739_911797746 4 Left 911797739 1:102095455-102095477 CCATAACTATAGCCCCATCACCA No data
Right 911797746 1:102095482-102095504 TCTGTCTGTAGCCCCGTCATGGG No data
911797743_911797746 -10 Left 911797743 1:102095469-102095491 CCATCACCAGGTGTCTGTCTGTA No data
Right 911797746 1:102095482-102095504 TCTGTCTGTAGCCCCGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911797746 Original CRISPR TCTGTCTGTAGCCCCGTCAT GGG Intergenic
No off target data available for this crispr