ID: 911798721

View in Genome Browser
Species Human (GRCh38)
Location 1:102107603-102107625
Sequence GCTCCTCCCATCTCTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798721_911798730 14 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798730 1:102107640-102107662 TCCTCAGGGGTTCTGACCTAGGG No data
911798721_911798732 23 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798721_911798723 -1 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798723 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
911798721_911798725 0 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798725 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
911798721_911798726 1 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798726 1:102107627-102107649 CTACAATCCATCCTCCTCAGGGG No data
911798721_911798729 13 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798729 1:102107639-102107661 CTCCTCAGGGGTTCTGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798721 Original CRISPR GCTCCTCCCATCTCTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr