ID: 911798722

View in Genome Browser
Species Human (GRCh38)
Location 1:102107625-102107647
Sequence CCTGAGGAGGATGGATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798722_911798737 21 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798737 1:102107669-102107691 AGGTGATTGTTGTAGGCAAGGGG No data
911798722_911798732 1 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798722_911798734 14 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798722_911798735 19 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798735 1:102107667-102107689 TAAGGTGATTGTTGTAGGCAAGG No data
911798722_911798736 20 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798722_911798729 -9 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798729 1:102107639-102107661 CTCCTCAGGGGTTCTGACCTAGG No data
911798722_911798730 -8 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798730 1:102107640-102107662 TCCTCAGGGGTTCTGACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798722 Original CRISPR CCTGAGGAGGATGGATTGTA GGG (reversed) Intergenic
No off target data available for this crispr