ID: 911798724

View in Genome Browser
Species Human (GRCh38)
Location 1:102107626-102107648
Sequence CCCTGAGGAGGATGGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798724_911798734 13 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798724_911798729 -10 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798729 1:102107639-102107661 CTCCTCAGGGGTTCTGACCTAGG No data
911798724_911798730 -9 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798730 1:102107640-102107662 TCCTCAGGGGTTCTGACCTAGGG No data
911798724_911798737 20 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798737 1:102107669-102107691 AGGTGATTGTTGTAGGCAAGGGG No data
911798724_911798732 0 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798724_911798736 19 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798724_911798735 18 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798735 1:102107667-102107689 TAAGGTGATTGTTGTAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798724 Original CRISPR CCCTGAGGAGGATGGATTGT AGG (reversed) Intergenic
No off target data available for this crispr