ID: 911798727

View in Genome Browser
Species Human (GRCh38)
Location 1:102107634-102107656
Sequence GTCAGAACCCCTGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798727_911798735 10 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798735 1:102107667-102107689 TAAGGTGATTGTTGTAGGCAAGG No data
911798727_911798732 -8 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798727_911798739 25 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798727_911798738 24 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798727_911798737 12 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798737 1:102107669-102107691 AGGTGATTGTTGTAGGCAAGGGG No data
911798727_911798740 26 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798727_911798736 11 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798727_911798734 5 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798727_911798741 27 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798741 1:102107684-102107706 GCAAGGGGATAAAGAGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798727 Original CRISPR GTCAGAACCCCTGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr