ID: 911798728

View in Genome Browser
Species Human (GRCh38)
Location 1:102107638-102107660
Sequence CTAGGTCAGAACCCCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798728_911798737 8 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798737 1:102107669-102107691 AGGTGATTGTTGTAGGCAAGGGG No data
911798728_911798739 21 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798728_911798738 20 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798728_911798736 7 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798728_911798734 1 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798728_911798740 22 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798728_911798741 23 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798741 1:102107684-102107706 GCAAGGGGATAAAGAGTTGGGGG No data
911798728_911798735 6 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798735 1:102107667-102107689 TAAGGTGATTGTTGTAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798728 Original CRISPR CTAGGTCAGAACCCCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr