ID: 911798729

View in Genome Browser
Species Human (GRCh38)
Location 1:102107639-102107661
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798724_911798729 -10 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798729 1:102107639-102107661 CTCCTCAGGGGTTCTGACCTAGG No data
911798721_911798729 13 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798729 1:102107639-102107661 CTCCTCAGGGGTTCTGACCTAGG No data
911798722_911798729 -9 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798729 1:102107639-102107661 CTCCTCAGGGGTTCTGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr