ID: 911798731

View in Genome Browser
Species Human (GRCh38)
Location 1:102107641-102107663
Sequence ACCCTAGGTCAGAACCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798731_911798741 20 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798741 1:102107684-102107706 GCAAGGGGATAAAGAGTTGGGGG No data
911798731_911798739 18 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798731_911798740 19 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798731_911798735 3 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798735 1:102107667-102107689 TAAGGTGATTGTTGTAGGCAAGG No data
911798731_911798736 4 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798731_911798738 17 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798731_911798737 5 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798737 1:102107669-102107691 AGGTGATTGTTGTAGGCAAGGGG No data
911798731_911798734 -2 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798731 Original CRISPR ACCCTAGGTCAGAACCCCTG AGG (reversed) Intergenic
No off target data available for this crispr