ID: 911798732

View in Genome Browser
Species Human (GRCh38)
Location 1:102107649-102107671
Sequence GTTCTGACCTAGGGTTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798721_911798732 23 Left 911798721 1:102107603-102107625 CCAAACAAAGAGATGGGAGGAGC No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798724_911798732 0 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798727_911798732 -8 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data
911798722_911798732 1 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798732 1:102107649-102107671 GTTCTGACCTAGGGTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798732 Original CRISPR GTTCTGACCTAGGGTTTTTA AGG Intergenic
No off target data available for this crispr