ID: 911798733

View in Genome Browser
Species Human (GRCh38)
Location 1:102107656-102107678
Sequence ACAATCACCTTAAAAACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798733_911798744 27 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798744 1:102107706-102107728 GTCATAGATCAGTCAGGGTGAGG No data
911798733_911798739 3 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798733_911798743 22 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798743 1:102107701-102107723 TGGGGGTCATAGATCAGTCAGGG No data
911798733_911798738 2 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798733_911798746 29 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798746 1:102107708-102107730 CATAGATCAGTCAGGGTGAGGGG No data
911798733_911798741 5 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798741 1:102107684-102107706 GCAAGGGGATAAAGAGTTGGGGG No data
911798733_911798747 30 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798747 1:102107709-102107731 ATAGATCAGTCAGGGTGAGGGGG No data
911798733_911798740 4 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798733_911798742 21 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798742 1:102107700-102107722 TTGGGGGTCATAGATCAGTCAGG No data
911798733_911798745 28 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798745 1:102107707-102107729 TCATAGATCAGTCAGGGTGAGGG No data
911798733_911798737 -10 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798737 1:102107669-102107691 AGGTGATTGTTGTAGGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798733 Original CRISPR ACAATCACCTTAAAAACCCT AGG (reversed) Intergenic
No off target data available for this crispr