ID: 911798734

View in Genome Browser
Species Human (GRCh38)
Location 1:102107662-102107684
Sequence GTTTTTAAGGTGATTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798722_911798734 14 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798727_911798734 5 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798731_911798734 -2 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798728_911798734 1 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data
911798724_911798734 13 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798734 Original CRISPR GTTTTTAAGGTGATTGTTGT AGG Intergenic
No off target data available for this crispr