ID: 911798736

View in Genome Browser
Species Human (GRCh38)
Location 1:102107668-102107690
Sequence AAGGTGATTGTTGTAGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798731_911798736 4 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798727_911798736 11 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798722_911798736 20 Left 911798722 1:102107625-102107647 CCCTACAATCCATCCTCCTCAGG No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798724_911798736 19 Left 911798724 1:102107626-102107648 CCTACAATCCATCCTCCTCAGGG No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data
911798728_911798736 7 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798736 1:102107668-102107690 AAGGTGATTGTTGTAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798736 Original CRISPR AAGGTGATTGTTGTAGGCAA GGG Intergenic
No off target data available for this crispr