ID: 911798738

View in Genome Browser
Species Human (GRCh38)
Location 1:102107681-102107703
Sequence TAGGCAAGGGGATAAAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798733_911798738 2 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798731_911798738 17 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798727_911798738 24 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data
911798728_911798738 20 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798738 1:102107681-102107703 TAGGCAAGGGGATAAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798738 Original CRISPR TAGGCAAGGGGATAAAGAGT TGG Intergenic
No off target data available for this crispr