ID: 911798739

View in Genome Browser
Species Human (GRCh38)
Location 1:102107682-102107704
Sequence AGGCAAGGGGATAAAGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798731_911798739 18 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798733_911798739 3 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798727_911798739 25 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data
911798728_911798739 21 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798739 1:102107682-102107704 AGGCAAGGGGATAAAGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798739 Original CRISPR AGGCAAGGGGATAAAGAGTT GGG Intergenic
No off target data available for this crispr