ID: 911798740

View in Genome Browser
Species Human (GRCh38)
Location 1:102107683-102107705
Sequence GGCAAGGGGATAAAGAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798727_911798740 26 Left 911798727 1:102107634-102107656 CCATCCTCCTCAGGGGTTCTGAC No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798728_911798740 22 Left 911798728 1:102107638-102107660 CCTCCTCAGGGGTTCTGACCTAG No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798733_911798740 4 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data
911798731_911798740 19 Left 911798731 1:102107641-102107663 CCTCAGGGGTTCTGACCTAGGGT No data
Right 911798740 1:102107683-102107705 GGCAAGGGGATAAAGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798740 Original CRISPR GGCAAGGGGATAAAGAGTTG GGG Intergenic
No off target data available for this crispr