ID: 911798747

View in Genome Browser
Species Human (GRCh38)
Location 1:102107709-102107731
Sequence ATAGATCAGTCAGGGTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911798733_911798747 30 Left 911798733 1:102107656-102107678 CCTAGGGTTTTTAAGGTGATTGT No data
Right 911798747 1:102107709-102107731 ATAGATCAGTCAGGGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911798747 Original CRISPR ATAGATCAGTCAGGGTGAGG GGG Intergenic
No off target data available for this crispr