ID: 911805063

View in Genome Browser
Species Human (GRCh38)
Location 1:102195446-102195468
Sequence ACTCCTACAATGTGTGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911805063_911805064 6 Left 911805063 1:102195446-102195468 CCTATGTCACACATTGTAGGAGT No data
Right 911805064 1:102195475-102195497 ATATCCTAAATTATAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911805063 Original CRISPR ACTCCTACAATGTGTGACAT AGG (reversed) Intergenic
No off target data available for this crispr