ID: 911818793

View in Genome Browser
Species Human (GRCh38)
Location 1:102389320-102389342
Sequence CTCAAACAGTCCTTCCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911818793_911818796 25 Left 911818793 1:102389320-102389342 CCACTAGGGAAGGACTGTTTGAG No data
Right 911818796 1:102389368-102389390 AAGGAGAAGTAGAAATTAGCAGG No data
911818793_911818795 6 Left 911818793 1:102389320-102389342 CCACTAGGGAAGGACTGTTTGAG No data
Right 911818795 1:102389349-102389371 GCATTTAAACTGATAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911818793 Original CRISPR CTCAAACAGTCCTTCCCTAG TGG (reversed) Intergenic
No off target data available for this crispr