ID: 911818795

View in Genome Browser
Species Human (GRCh38)
Location 1:102389349-102389371
Sequence GCATTTAAACTGATAATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911818793_911818795 6 Left 911818793 1:102389320-102389342 CCACTAGGGAAGGACTGTTTGAG No data
Right 911818795 1:102389349-102389371 GCATTTAAACTGATAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911818795 Original CRISPR GCATTTAAACTGATAATTAA AGG Intergenic
No off target data available for this crispr