ID: 911830526

View in Genome Browser
Species Human (GRCh38)
Location 1:102545370-102545392
Sequence TCATAGGCTTACAGCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911830526_911830530 16 Left 911830526 1:102545370-102545392 CCTCTCCAGCTGTAAGCCTATGA No data
Right 911830530 1:102545409-102545431 TATTTAGAAAATAACTATGGTGG No data
911830526_911830529 13 Left 911830526 1:102545370-102545392 CCTCTCCAGCTGTAAGCCTATGA No data
Right 911830529 1:102545406-102545428 AGCTATTTAGAAAATAACTATGG No data
911830526_911830531 22 Left 911830526 1:102545370-102545392 CCTCTCCAGCTGTAAGCCTATGA No data
Right 911830531 1:102545415-102545437 GAAAATAACTATGGTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911830526 Original CRISPR TCATAGGCTTACAGCTGGAG AGG (reversed) Intergenic
No off target data available for this crispr