ID: 911841455

View in Genome Browser
Species Human (GRCh38)
Location 1:102687170-102687192
Sequence GGATCTCTGCTAACTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911841450_911841455 28 Left 911841450 1:102687119-102687141 CCTGAAGGTGTGCTGGGAGGCAA No data
Right 911841455 1:102687170-102687192 GGATCTCTGCTAACTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911841455 Original CRISPR GGATCTCTGCTAACTCCAGG AGG Intergenic
No off target data available for this crispr