ID: 911849547

View in Genome Browser
Species Human (GRCh38)
Location 1:102799884-102799906
Sequence ACATCAACAGAGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911849543_911849547 -1 Left 911849543 1:102799862-102799884 CCATCTACATTACTCCAACCAAA 0: 1
1: 0
2: 0
3: 18
4: 154
Right 911849547 1:102799884-102799906 ACATCAACAGAGATGGAACATGG 0: 1
1: 0
2: 1
3: 23
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911849547 Original CRISPR ACATCAACAGAGATGGAACA TGG Intergenic
900385641 1:2409394-2409416 CCATCCACAGAGATGGAAACGGG - Intronic
900949513 1:5850463-5850485 CCATCCACAGACATGGAAAAAGG - Intergenic
903067289 1:20707397-20707419 ACAGCAAGGGAGATGGAACCAGG + Intronic
903110255 1:21126722-21126744 ACATTAATAGAGATGGATCTAGG + Intronic
903133401 1:21293594-21293616 AAATCAGCAGAGATGGAGCCTGG + Intronic
905675258 1:39820285-39820307 ACGTCTTCAGAGATGGCACATGG + Intergenic
905787146 1:40767354-40767376 ACATCACCAGAAATGCAACTGGG - Intronic
906472002 1:46138960-46138982 ACATCAACAGGGAAGGAATAGGG - Intronic
907063409 1:51454453-51454475 ACATCAATAGTGATGTCACATGG + Intronic
907091832 1:51732076-51732098 ATATCAACAGAGATTGAAGTGGG - Intronic
908330784 1:63068862-63068884 ACACCAAGAGAGATGAATCATGG + Intergenic
909272017 1:73634907-73634929 ACATCAACAGATAGTCAACAAGG + Intergenic
910489443 1:87752604-87752626 ACAGCAAAAGAGTTGGAAAAAGG + Intergenic
910762866 1:90752095-90752117 ACATCAATAGTGGTGAAACAGGG - Intergenic
911244200 1:95498826-95498848 ACATCCACTGAGATGTGACAGGG + Intergenic
911712286 1:101088029-101088051 ACATGAGCAGAGATGATACACGG - Intergenic
911828780 1:102523640-102523662 ACCTCAACAGGGATGGTACCAGG - Intergenic
911849547 1:102799884-102799906 ACATCAACAGAGATGGAACATGG + Intergenic
912563901 1:110571516-110571538 ACATCAGCAGAGGTGGAGGAGGG + Intergenic
917040975 1:170806015-170806037 AAATCAAAAAAGATGGAACAAGG + Intergenic
917660985 1:177176641-177176663 ACATAAAAAGAGAAAGAACATGG + Intronic
917855129 1:179093388-179093410 CCCTTAACAGAGGTGGAACACGG - Intronic
918038815 1:180899669-180899691 ACAGCAAGAGAGATGGGACTGGG + Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918289834 1:183096470-183096492 AGATGAACAGAGATGGAATATGG - Intronic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
919920138 1:202162475-202162497 ACATCCACCCAGAGGGAACAGGG - Intergenic
921103254 1:211949998-211950020 ACATCAAAAGATAGGGAAAATGG - Intronic
921235647 1:213125069-213125091 ATATCAAAAGAGATGCATCAAGG - Intronic
921740808 1:218682296-218682318 GAATCAACAGAGATGCCACAAGG + Intergenic
923518884 1:234720838-234720860 ACCTCAACAGTGATGGACAAGGG + Intergenic
923867331 1:237953943-237953965 TCTTCAATAGAGATGCAACAAGG + Intergenic
924069357 1:240260046-240260068 ACAGCAACCTAGATGGAACTGGG - Intronic
924578200 1:245299947-245299969 ACATCAACAGAGATGTTCCCAGG - Intronic
1062905126 10:1174650-1174672 TCATCAACAGAGATGAAGCCGGG - Intergenic
1062990197 10:1807496-1807518 CCAGCAACAGAGATGGTACAGGG + Intergenic
1063070172 10:2653763-2653785 ACATGGACAGAGAAGGACCATGG - Intergenic
1066270133 10:33814203-33814225 ACATCATCAATAATGGAACAAGG + Intergenic
1067097046 10:43308326-43308348 ACATCCACAGAGACGGAAAGTGG - Intergenic
1068514422 10:58008453-58008475 ACAGCAACACAGAGGGAAGAAGG + Intergenic
1068748972 10:60569488-60569510 ACATAAACAGCTATGGAATATGG + Intronic
1071472524 10:85993863-85993885 ACATCATCAGAGACGGAAAGGGG - Intronic
1073026545 10:100491058-100491080 TCATCATCAGAGATGAAACAGGG + Intronic
1073761339 10:106631871-106631893 ACATCAAGAGAGATAGAAATTGG - Intronic
1075190957 10:120308266-120308288 GCATCAACAGAGATGGGAAGGGG - Intergenic
1076036799 10:127205392-127205414 ACCACAACAGAGATGGAACGTGG - Intronic
1077988525 11:7380137-7380159 GCAACAACACAGATGGAACTGGG + Intronic
1079825466 11:25185816-25185838 CCATCAAAAAAGATGGAAAAAGG - Intergenic
1080335264 11:31188221-31188243 ACAACAACAGAGATAGTAAACGG + Intronic
1082663711 11:55948417-55948439 ATATCAACAGACATGGAGCCAGG + Intergenic
1084540755 11:69785287-69785309 CCATCAACAGAAATAGAAAATGG - Intergenic
1085639094 11:78180025-78180047 ACAGCATAAGAGATGGACCAAGG - Intronic
1085879934 11:80454621-80454643 ACATCCACAGAGAACTAACAGGG - Intergenic
1087654725 11:100908535-100908557 ACAGCAACATAGATGGAACTGGG - Intronic
1089944749 11:122457426-122457448 ACAGCAACATATATGGAACTAGG + Intergenic
1090601052 11:128371685-128371707 AGATCAACAGAGACAGAGCAGGG + Intergenic
1090685492 11:129113424-129113446 ACATAAACACAGACTGAACATGG - Intronic
1091314660 11:134605073-134605095 ACATGGCCAGAGAAGGAACAAGG + Intergenic
1091547384 12:1510493-1510515 ACAAAAGCAGAGAAGGAACAAGG + Intergenic
1091706248 12:2695398-2695420 ACATCAGCAGAGGGGGGACAGGG - Intronic
1091711479 12:2743628-2743650 ACATCAGCAGAGGGGGGACAGGG - Intergenic
1092673042 12:10884691-10884713 ACATCATGAGAGATGGAAAGAGG - Intronic
1092676676 12:10928777-10928799 ACATCATGAGAGATGGAAATAGG + Intronic
1092704762 12:11270123-11270145 ACATCACGAGAGATGGAAATAGG - Intergenic
1092708672 12:11310847-11310869 ACATCACAAGAGATGGAAATAGG - Intergenic
1092712866 12:11356009-11356031 ACATCACAAGAGATGGAAATAGG - Intronic
1092716662 12:11395985-11396007 ACATCACAAGAGATGGAAATAGG - Intronic
1092728178 12:11504685-11504707 ACATCAATAGAGGGGGAACAGGG + Intergenic
1092733401 12:11556215-11556237 AGATCAGCAGACATGGAGCAGGG - Intergenic
1092839171 12:12522484-12522506 ATATAAGCAGAGATGGACCAGGG - Intronic
1095270682 12:40215089-40215111 GTACCACCAGAGATGGAACAAGG - Intronic
1095551161 12:43441220-43441242 ACATGAACAGAGAAGGAAATAGG - Intronic
1095627123 12:44328967-44328989 ACTTCCACAGAGATGCCACATGG + Intronic
1095881987 12:47147631-47147653 ATATCAATAGAAATAGAACATGG - Intronic
1097220948 12:57450715-57450737 ACCTAGACAGAGAGGGAACAGGG - Exonic
1097470071 12:59978561-59978583 ACATCCCCCTAGATGGAACATGG + Intergenic
1097489707 12:60250751-60250773 ACTGCAACTGAGATGGAAGAAGG + Intergenic
1097726527 12:63081395-63081417 ACATAAAAAGAGGTTGAACAGGG + Intergenic
1097872609 12:64613625-64613647 ACAACAACAAAAATGGAAAAGGG + Intronic
1098591066 12:72213534-72213556 AAATTAACAGAGCTAGAACAGGG + Intronic
1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG + Intergenic
1098841131 12:75479431-75479453 AAATTAAGAGAGATGGAAAATGG - Intergenic
1100995890 12:100300793-100300815 GCAACAACATAGATGGAACTGGG - Intronic
1101582875 12:106059215-106059237 ATATCAACAGAGATGGCAACAGG + Intergenic
1102675166 12:114652945-114652967 ACATCACCATAGCTAGAACACGG - Intergenic
1104402058 12:128484452-128484474 ATATCATCATATATGGAACATGG - Intronic
1105028619 12:132867204-132867226 ACATCAACAGAAGTGGAAACAGG + Intronic
1107006571 13:35619280-35619302 ACTTCAACAGGGATGGCACCAGG + Intronic
1109369285 13:61400232-61400254 ACATCAACAGAAAAGGTCCAAGG + Intergenic
1109852934 13:68090804-68090826 ACATTAACAAAGATGCAATATGG + Intergenic
1109971418 13:69775238-69775260 ACATCTAAAGAGATGGAGCAAGG + Intronic
1110657438 13:78016984-78017006 AAATCAACCAAGATGGATCAAGG - Intergenic
1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG + Intergenic
1112315140 13:98354403-98354425 ACATAACCAGATATGAAACATGG + Intronic
1113270511 13:108668617-108668639 ACATCAACAGTGATGGATACGGG + Intronic
1113807955 13:113120961-113120983 AGATCAGCATGGATGGAACAAGG + Intergenic
1114390842 14:22306790-22306812 ACATCAAAACAGATGAGACAGGG - Intergenic
1114671578 14:24414571-24414593 ACACCAAAACAGATGGAAGAGGG - Intronic
1120084667 14:80257216-80257238 ACAGCAGCAGAGCTGGAATAAGG - Intronic
1120613387 14:86671158-86671180 GCAACAACATAGATGGAACTGGG - Intergenic
1121592887 14:95132537-95132559 ACTTCAGCAGAAATGGAAAAAGG - Exonic
1124013085 15:25854412-25854434 TCATCAATAGAGAAGGAATAGGG + Intronic
1125030147 15:35068069-35068091 ACATCCACAGAGAAGTAACCAGG - Intergenic
1126221920 15:46223925-46223947 ACATCAAAAAAGATAGAAAAGGG - Intergenic
1128215822 15:65933430-65933452 CCATCAACAGACCTGCAACAGGG - Intronic
1128355535 15:66923872-66923894 AGGTCAGCAGGGATGGAACAAGG + Intergenic
1128985802 15:72220358-72220380 ACAAAGTCAGAGATGGAACAGGG - Intronic
1129135762 15:73549209-73549231 ACAACAACATGGATGGAACTGGG + Intronic
1131683017 15:94743861-94743883 GCATCCACAGAGCTGGAAGAAGG - Intergenic
1132006717 15:98233904-98233926 ACATCCACAGAAATGTGACAAGG + Intergenic
1132193560 15:99891497-99891519 TCATCAGCAGAGATGGCACTCGG - Intergenic
1133969421 16:10556905-10556927 AGATCAGCAGAGAGGGCACAAGG + Intronic
1135002057 16:18785032-18785054 GCATGCAAAGAGATGGAACAAGG + Intronic
1135628424 16:24016175-24016197 ACATCAAGAGAGCTGGCCCAAGG + Intronic
1135898095 16:26428853-26428875 GCAGCAACATAGATGGAACTGGG + Intergenic
1136694674 16:32066939-32066961 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136795176 16:33010201-33010223 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136874740 16:33844181-33844203 AAGTCTACAGAGATGGAAAATGG + Intergenic
1137866108 16:51898378-51898400 AAATCAATAGCAATGGAACAAGG + Intergenic
1139332038 16:66200545-66200567 AAATCCACAGAGATGCAAAAGGG + Intergenic
1139798035 16:69498713-69498735 ACATAGACAGAGATGGATAAGGG - Intergenic
1140952188 16:79829233-79829255 ACAACAACAGAAAGAGAACAAGG + Intergenic
1141796038 16:86274936-86274958 ACATACACAGAGAGGGGACATGG - Intergenic
1203097431 16_KI270728v1_random:1271861-1271883 AAGTCTACAGAGATGGAAAATGG - Intergenic
1143626549 17:8113668-8113690 ACAACAAAAGGAATGGAACATGG + Intronic
1143707386 17:8708264-8708286 ACAAGAACAGAGCAGGAACAGGG + Intergenic
1146670614 17:34734922-34734944 ACTTCAATAGAGATGGCACCAGG + Intergenic
1149354331 17:55824417-55824439 ACATGCACTGAGATGGAACAAGG - Intronic
1149356947 17:55848773-55848795 ACAGCAACAGAGCTGGAAGTTGG + Intergenic
1150888544 17:69116546-69116568 ACATTTACAAAGATTGAACAAGG + Intronic
1154166078 18:12015441-12015463 ACAGCAGCAGAGATGGGCCATGG - Intronic
1154412503 18:14148966-14148988 ACACCAACAGACTTGGAACTCGG - Intergenic
1154941615 18:21118617-21118639 ACATCAACAGTGATGGTAATTGG - Intergenic
1156076960 18:33290472-33290494 AAATAAACAGAGATAGATCATGG + Intronic
1157006228 18:43588388-43588410 GCATCAACTGAGAAGGAACAAGG + Intergenic
1157901088 18:51518510-51518532 ACATGAACTCAGATGGAGCAGGG + Intergenic
1160160330 18:76465830-76465852 ACGAAAACAGAGATGGACCAAGG + Intronic
1162582065 19:11537558-11537580 ATATGTACAGAGTTGGAACATGG + Intergenic
1163204779 19:15794585-15794607 ACTTCAACAGAGGTGGCACGTGG - Exonic
1163206523 19:15807479-15807501 ACTTCAACAGAGGTGGCACATGG + Exonic
1164715725 19:30389024-30389046 AAATCAAGAGAGATGGGGCATGG - Intronic
1164975529 19:32570234-32570256 ACAGCAACAGAGATGGACGAGGG + Intergenic
1165163518 19:33832955-33832977 ACATCGACAGAGATGGGGCAGGG + Intergenic
1166458610 19:42966568-42966590 ACATCATGTGAGATGGATCAGGG - Intronic
1166630476 19:44401975-44401997 TCATCAACAGAAATAAAACATGG - Intergenic
1167397199 19:49238338-49238360 AAATCAACTAAGATGGATCAAGG - Intergenic
1167575350 19:50315198-50315220 AGATGGACAGAGATGGACCAAGG + Intronic
925988090 2:9231967-9231989 AGATCAAGAGAGATGGAAGCAGG - Intronic
926313483 2:11692459-11692481 ACATCAACAGGGGTAGAACCCGG - Intronic
926654756 2:15389588-15389610 ACATGAAAAGACATGGATCAAGG + Intronic
927228350 2:20793643-20793665 ACATTAAAAGAGATTGAGCAGGG + Intronic
929660944 2:43784136-43784158 TCATCAAAAGAGATGGAATTTGG + Intronic
930363831 2:50413875-50413897 GCAACAACACAGATGGAACTGGG + Intronic
931896922 2:66742741-66742763 AAACCAGCAGAGAGGGAACAGGG + Intergenic
932947643 2:76255509-76255531 ACACCCACACAGATGGTACAGGG - Intergenic
933093086 2:78145906-78145928 ACATCAGCAGAGTGGGCACATGG - Intergenic
933264042 2:80162466-80162488 ACAGTAGCAGAGATGGAAAATGG - Intronic
936037159 2:109122284-109122306 ACATCAACAGGGATTGGAAAGGG + Intergenic
936725929 2:115315743-115315765 ACAACAGCACAGATTGAACATGG + Intronic
937336414 2:121065066-121065088 ACAGTTACAGAGATAGAACAGGG - Intergenic
937449636 2:121991668-121991690 GCATCATTAGAGATGGAAAATGG - Intergenic
939431465 2:142114612-142114634 ACAGCAACATAGATGGAACTGGG + Intronic
940693491 2:156949592-156949614 ACATGATCAGAGCTGGCACAAGG + Intergenic
940844623 2:158626184-158626206 ACATCAACTGTGATGGGACTGGG - Intronic
941934475 2:170972361-170972383 GCTTCAGAAGAGATGGAACAAGG - Intergenic
942367840 2:175247334-175247356 GCAAGAGCAGAGATGGAACATGG + Intergenic
943236917 2:185334195-185334217 GCAACAACAGAGATGAAACTGGG - Intergenic
943388467 2:187231743-187231765 ACATCAAAAGAGATGGGGGAGGG - Intergenic
943877288 2:193085910-193085932 ATATTAACAGAGATGGAATATGG + Intergenic
946601134 2:221361539-221361561 ACCTCAGCAGAGAGGGAGCAGGG - Intergenic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
948371206 2:237490090-237490112 ATCTAAACAGAAATGGAACAAGG + Intronic
948553329 2:238790739-238790761 ACATCTACAGACATGGAATACGG + Intergenic
948679826 2:239626236-239626258 ACCACCCCAGAGATGGAACAAGG + Intergenic
948763043 2:240204402-240204424 AATTGAACAGAGCTGGAACAGGG + Intergenic
949000935 2:241612715-241612737 ACATCTACAGAGACAGAACGTGG + Intronic
1169596648 20:7207704-7207726 ACATCAACAGATGGGGAAAAAGG - Intergenic
1172208735 20:33182616-33182638 GCCTCAGCAGAGATGCAACACGG + Intergenic
1172590284 20:36112918-36112940 ACATCAACATTGGTGGATCAGGG + Intronic
1173227949 20:41172857-41172879 ACCTCAATAGAGATGGCACATGG - Exonic
1173441583 20:43082008-43082030 ACATCAAAAAAGATGAAAAATGG - Intronic
1176860507 21:14009290-14009312 ACACCAACAGACTTGGAACTCGG + Intergenic
1178055380 21:28792553-28792575 ACATCATCTGAGATAGACCATGG - Intergenic
1179015833 21:37593940-37593962 ACATAAACAGAGAAGCACCAGGG - Intergenic
1179953707 21:44726312-44726334 TCAGCAACATAGATGGAACTGGG + Intergenic
1180220020 21:46352603-46352625 ACAGCAGCAGAGAAGCAACACGG - Intronic
1181623644 22:24107477-24107499 ACATCCACAGCAGTGGAACAGGG - Intronic
1182886961 22:33782292-33782314 AAATCCACAGAGACAGAACATGG + Intronic
1183407081 22:37635489-37635511 AAATCAACAGAAATGGAAGTGGG - Intronic
1183604585 22:38860970-38860992 ACCTCAAGAGAGAAGGCACATGG + Intergenic
949128050 3:470102-470124 ACATGACCAGAAATGTAACAAGG - Intergenic
950011911 3:9729964-9729986 ACATCAAGAGGGAGGGAACCAGG + Intergenic
951275787 3:20684270-20684292 ATATCAAAAGTGATGGGACAGGG - Intergenic
956484845 3:69711297-69711319 TCATCACCAGTGATTGAACATGG - Intergenic
956845419 3:73178005-73178027 ACATTATCAGATTTGGAACAAGG - Intergenic
958877412 3:99631984-99632006 CCATCAACAGGGTTTGAACAAGG + Intergenic
959534446 3:107469567-107469589 ACATAATCAGTGATGGTACAAGG + Intergenic
959674725 3:109021372-109021394 ACATCAGCAGAGATGGAGAGAGG - Intronic
959921229 3:111870529-111870551 ACATCAAAACACATGGAAGAGGG - Intronic
961072654 3:123949464-123949486 ACATGAACTGACAAGGAACAAGG - Intronic
963260456 3:143186817-143186839 TCATCAACAGAGAAGGAGGATGG + Intergenic
963463150 3:145643335-145643357 ACATCAAAAGACATGGAGAATGG - Intergenic
965584102 3:170300192-170300214 CCATTAACAGTGATGGAAAAAGG - Intronic
968502726 4:958522-958544 TCCTCACCAGAGATGGACCAGGG + Exonic
969079935 4:4610514-4610536 ACATAAACAGGGATGGGAGAAGG + Intergenic
970340491 4:15101363-15101385 ACATGAACAGAGATGCAACAAGG + Intergenic
971628371 4:28954918-28954940 ACAGCAACAGGGATGGAATTGGG - Intergenic
973186884 4:47340379-47340401 ACAGCACCAGATTTGGAACATGG - Intronic
975164023 4:71156655-71156677 ATATCAAAAGAGATGTAACAGGG + Intergenic
975713703 4:77185914-77185936 AGATAAACAGAGAAGGAACTGGG - Intronic
975909612 4:79251322-79251344 GCAGCAACAGGGATGGAACTGGG + Intronic
976462803 4:85332518-85332540 ACAGCAAAACAAATGGAACAGGG - Intergenic
978017856 4:103769684-103769706 ACAACAACAATGATGAAACAGGG - Intergenic
979387175 4:120080522-120080544 AAATCATCAGATATGGAAGATGG - Intergenic
979396128 4:120191737-120191759 CCATCACCAAAGATGAAACAGGG - Intergenic
980064975 4:128177005-128177027 ATATGAAAAGATATGGAACAAGG + Intronic
980158001 4:129130003-129130025 AGATCAACAGAGATAGAAATGGG - Intergenic
980209615 4:129770334-129770356 AGATCAAAAGATATGTAACAAGG + Intergenic
980889988 4:138804553-138804575 ACAGAGAAAGAGATGGAACAGGG - Intergenic
981187608 4:141822366-141822388 ACATTAACAGAAGTAGAACAAGG + Intergenic
986306479 5:6520404-6520426 AAGTCAGCAGAGATGGACCATGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
987250768 5:16099019-16099041 ACATCAAAAGAGTAGAAACAAGG - Intronic
988171573 5:27663860-27663882 CCATCAAAGGAGATGGAAAAGGG - Intergenic
989490867 5:42051321-42051343 ACATCAATAGTGATCAAACATGG - Intergenic
990604972 5:57400008-57400030 ACAGCAACATGGATGGAACTGGG - Intergenic
992090768 5:73314159-73314181 ACATCCACACAGTTGGGACAAGG + Intergenic
992172329 5:74115899-74115921 ATATCTACAGTGATGGAAAATGG + Intergenic
992721253 5:79563582-79563604 ACATCAAAAGGGGTGGAGCAGGG + Intergenic
993421738 5:87711173-87711195 ACATGAACAGAGGTGAAACATGG + Intergenic
993530790 5:89022694-89022716 ATAACAAAAGAGATGGAATAGGG + Intergenic
993754571 5:91712123-91712145 ACATCAACAGAAATGGTAACTGG - Intergenic
993919669 5:93785226-93785248 ACATCAAAAGAAATGAAAAAAGG + Intronic
996907425 5:128616919-128616941 ACCTGAAAAGAGATGGAACTGGG - Intronic
997192527 5:131951272-131951294 TCATTAACAGAGATAGAAAAAGG - Exonic
997447061 5:133948252-133948274 ACATGACAAGAGAGGGAACAAGG + Intergenic
997791609 5:136767262-136767284 ACATACACAGGGGTGGAACATGG - Intergenic
997891126 5:137677874-137677896 ACATCAACACAGATGAAAATGGG + Intronic
998215574 5:140236287-140236309 ACATCCACAGAAATGCCACAAGG - Intronic
999369210 5:151042989-151043011 AGATGAGCAGAGAAGGAACAAGG + Intronic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1002072354 5:176687756-176687778 ACATGAACAGGGCTGAAACACGG - Intergenic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1005204293 6:23383000-23383022 ACAGCAACAGAAATGAAAAATGG - Intergenic
1010217396 6:73416157-73416179 ACATCAACAGAAAAGGGAAATGG + Exonic
1012718077 6:102701996-102702018 ACAACATCAGAGCAGGAACAGGG + Intergenic
1013155536 6:107489324-107489346 AGATAAAGAGAGAAGGAACAAGG + Intergenic
1013659888 6:112284368-112284390 ACCTCAATAGAGATGGCACCAGG - Intergenic
1014141266 6:117945902-117945924 ACATCAAAAGAGAGAGACCAGGG + Intronic
1014839966 6:126207375-126207397 AGACCAACAGAGATGGGAGATGG + Intergenic
1014910132 6:127082212-127082234 AGATGAACAGAAATGGAATATGG + Intergenic
1016824977 6:148379860-148379882 AGATCAGCGGTGATGGAACATGG - Intronic
1017023010 6:150156204-150156226 ACCTCAAAAGAGATTGAGCATGG - Intronic
1018087036 6:160311319-160311341 ACATCAAAAGAGAAGAAAGAGGG - Intergenic
1019076855 6:169394841-169394863 TCTTCAGCAGAGAGGGAACATGG + Intergenic
1021814452 7:24433621-24433643 ACCTCAACAGGGATGGCACCAGG + Intergenic
1022518562 7:30990820-30990842 ACAGAAACAGACATGAAACAAGG - Intronic
1022740558 7:33116355-33116377 GCAACAACATAGATGGAACTGGG - Intergenic
1022937452 7:35193484-35193506 ATATCCATAGAGATGGAAAATGG - Intergenic
1022947403 7:35301105-35301127 ACTTCAATAGAGATGGCACCAGG - Intergenic
1022971336 7:35520159-35520181 ACCTCAACAGAGATGCACCGAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026111999 7:67465795-67465817 ACATTAACAAAGAGGGAATACGG - Intergenic
1026154814 7:67817744-67817766 AGACCAACAGAGTTGGACCAGGG - Intergenic
1026326551 7:69315492-69315514 ATAGCAACAGAGACGGAAAAAGG - Intergenic
1029616699 7:101663765-101663787 AGATGAAATGAGATGGAACATGG - Intergenic
1030689499 7:112517832-112517854 ACTTCAACAGAGTTGGAGCATGG + Intergenic
1031519208 7:122742723-122742745 ACATCTAGCAAGATGGAACATGG - Intronic
1031854150 7:126901555-126901577 ATATAAACAGAGACAGAACAAGG - Intronic
1033014771 7:137661188-137661210 GAATCACCAGAGATGGGACATGG + Intronic
1035038790 7:155912640-155912662 ACAAAAACACAGATGAAACAAGG + Intergenic
1037208464 8:16355035-16355057 TCACCAACAGAGGTGGAAAAAGG + Intronic
1040799620 8:51325995-51326017 ACATCAACAGACACAGAAAAAGG - Intronic
1041207889 8:55516972-55516994 GCAGCAACATAGATGGAACTGGG + Intronic
1041306338 8:56465058-56465080 TCAAAAACTGAGATGGAACAGGG - Intergenic
1041702456 8:60806473-60806495 CCAGCAACATAAATGGAACATGG - Intronic
1042389100 8:68212376-68212398 TCATCAAAAGAGATGGGACTTGG + Intronic
1043188461 8:77185680-77185702 AAATCAACCAAGATGGATCAAGG + Intergenic
1043555158 8:81421733-81421755 ACTTCAACAGAAATGGCACCAGG - Intergenic
1044406401 8:91831761-91831783 ACATTCACAGAAATGGAAAACGG + Intergenic
1044912674 8:97077537-97077559 ACATAAACACAGATTGTACATGG - Intronic
1045761344 8:105611583-105611605 ACAGGAACAGAGATGGGAGAAGG + Intronic
1046373600 8:113346141-113346163 AGATCAATAGAGATAGACCATGG + Intronic
1047068045 8:121309269-121309291 ACAGAAACAGAGATTGAAAATGG - Intergenic
1048705921 8:137153932-137153954 GCAACAACACAGATGGAACTGGG - Intergenic
1048745139 8:137606151-137606173 ACATGAACAGAGGTGGAAAGTGG + Intergenic
1051962395 9:22783315-22783337 ACATCAACTGATATAGAAAATGG + Intergenic
1053201344 9:36153543-36153565 CCATGAACAGAGATGCAGCAAGG - Intronic
1055472888 9:76631310-76631332 ACATCAATAAAGAGAGAACATGG - Intronic
1056818389 9:89818257-89818279 ACATCAACAGAGATAAGTCATGG + Intergenic
1058078556 9:100676164-100676186 AAAACAACAGAGTTGGAAGAAGG + Intergenic
1059218135 9:112585984-112586006 ACAGCAACAGAGAAAAAACATGG + Intronic
1060203856 9:121670112-121670134 AAAGCAATAGAGATGGAAAACGG - Intronic
1060717288 9:125944209-125944231 AAATCAAAAGAGAAGAAACAAGG - Intronic
1186260747 X:7776520-7776542 ACATCCACAGAGAGAGAAAAGGG - Intergenic
1186861012 X:13672577-13672599 AAATCTACAGAGATGGAAAGTGG + Intronic
1189143813 X:38635524-38635546 TCATCAACTGAGATGGGAAATGG - Intronic
1189553385 X:42115964-42115986 AGAGCTACAGGGATGGAACAAGG - Intergenic
1193347073 X:80416005-80416027 ACAACAACTGAGATTGAACCAGG - Intronic
1194225139 X:91246984-91247006 TCAACAACATAGATGGAACTGGG - Intergenic
1194265544 X:91749254-91749276 ACAGAAACAAAGATGGATCAAGG + Intergenic
1194805591 X:98323462-98323484 ACAGCACCATATATGGAACAGGG - Intergenic
1195580917 X:106501709-106501731 AGATGAAGAGAGATGGGACATGG + Intergenic
1195687388 X:107599311-107599333 ACAGCAACAGAAAAGGAATAGGG + Intronic
1198657985 X:138935422-138935444 TTAACAACAGAGATGGTACAAGG + Intronic
1198700143 X:139388040-139388062 ACAGCAACAGAGTTGAAATAGGG - Intergenic
1200561607 Y:4710291-4710313 TCAACAACATAGATGGAACTAGG - Intergenic
1200582696 Y:4969702-4969724 ACAGAAACAAAGATGGAGCAAGG + Intergenic
1201708054 Y:16958597-16958619 AGATCAACAGAGCTGGAAAAAGG + Intergenic