ID: 911850383

View in Genome Browser
Species Human (GRCh38)
Location 1:102811184-102811206
Sequence GCTTTTAAGGGGTTCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911850375_911850383 -1 Left 911850375 1:102811162-102811184 CCCCAAGGAGTTCTGGGCTGGGG No data
Right 911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG No data
911850368_911850383 14 Left 911850368 1:102811147-102811169 CCCTCAAATTCATCTCCCCAAGG No data
Right 911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG No data
911850370_911850383 13 Left 911850370 1:102811148-102811170 CCTCAAATTCATCTCCCCAAGGA 0: 12
1: 31
2: 55
3: 127
4: 359
Right 911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG No data
911850377_911850383 -2 Left 911850377 1:102811163-102811185 CCCAAGGAGTTCTGGGCTGGGGC No data
Right 911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG No data
911850378_911850383 -3 Left 911850378 1:102811164-102811186 CCAAGGAGTTCTGGGCTGGGGCT No data
Right 911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911850383 Original CRISPR GCTTTTAAGGGGTTCCTGGA TGG Intergenic
No off target data available for this crispr