ID: 911855281

View in Genome Browser
Species Human (GRCh38)
Location 1:102868818-102868840
Sequence AGCTGTACCCTGCAAAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911855281_911855286 4 Left 911855281 1:102868818-102868840 CCCTGACTTTGCAGGGTACAGCT No data
Right 911855286 1:102868845-102868867 TCCTGGCTTCTTTCACGGGCTGG No data
911855281_911855289 30 Left 911855281 1:102868818-102868840 CCCTGACTTTGCAGGGTACAGCT No data
Right 911855289 1:102868871-102868893 TGAGTTGCTGTGGCTTTTCTAGG No data
911855281_911855288 20 Left 911855281 1:102868818-102868840 CCCTGACTTTGCAGGGTACAGCT No data
Right 911855288 1:102868861-102868883 GGGCTGGTGTTGAGTTGCTGTGG No data
911855281_911855285 0 Left 911855281 1:102868818-102868840 CCCTGACTTTGCAGGGTACAGCT No data
Right 911855285 1:102868841-102868863 ACTCTCCTGGCTTCTTTCACGGG No data
911855281_911855284 -1 Left 911855281 1:102868818-102868840 CCCTGACTTTGCAGGGTACAGCT No data
Right 911855284 1:102868840-102868862 TACTCTCCTGGCTTCTTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911855281 Original CRISPR AGCTGTACCCTGCAAAGTCA GGG (reversed) Intergenic
No off target data available for this crispr