ID: 911856365

View in Genome Browser
Species Human (GRCh38)
Location 1:102882136-102882158
Sequence CCTTGGCTATGGAGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911856365_911856369 11 Left 911856365 1:102882136-102882158 CCATCTTCACTCCATAGCCAAGG No data
Right 911856369 1:102882170-102882192 AAGTATTTAGCCAGTAGCTAAGG 0: 1
1: 0
2: 1
3: 7
4: 110
911856365_911856371 30 Left 911856365 1:102882136-102882158 CCATCTTCACTCCATAGCCAAGG No data
Right 911856371 1:102882189-102882211 AAGGAGATATACTGTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911856365 Original CRISPR CCTTGGCTATGGAGTGAAGA TGG (reversed) Intronic
No off target data available for this crispr