ID: 911856960

View in Genome Browser
Species Human (GRCh38)
Location 1:102890459-102890481
Sequence CAAAGGTGACCCTGGCTCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911856960_911856964 -6 Left 911856960 1:102890459-102890481 CCTTGGAGCCAGGGTCACCTTTG 0: 1
1: 1
2: 3
3: 23
4: 243
Right 911856964 1:102890476-102890498 CCTTTGAGACCAGGTAAGCCAGG 0: 1
1: 0
2: 2
3: 34
4: 366
911856960_911856965 -3 Left 911856960 1:102890459-102890481 CCTTGGAGCCAGGGTCACCTTTG 0: 1
1: 1
2: 3
3: 23
4: 243
Right 911856965 1:102890479-102890501 TTGAGACCAGGTAAGCCAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911856960 Original CRISPR CAAAGGTGACCCTGGCTCCA AGG (reversed) Exonic
900642847 1:3695585-3695607 CAGAGTGGACACTGGCTCCATGG - Intronic
901841562 1:11957095-11957117 GGAAGGTGGCCCTGGCCCCAGGG - Intronic
902620841 1:17649962-17649984 CAAAGCTGACCCAGCCTGCAAGG - Intronic
902929742 1:19722735-19722757 CAAGGGTTTCCCTGGTTCCAAGG + Intronic
903293599 1:22329967-22329989 CAAAGGTGAGCAAGGCTCCTGGG - Intergenic
905733758 1:40312748-40312770 CAAGGGGGAGCCTGGCCCCATGG - Exonic
906142481 1:43542080-43542102 CACAGGTGACCCTGGGACCCTGG + Intronic
906376500 1:45300936-45300958 CAAAGTTAACTCTGGCTACAGGG + Intronic
908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG + Intronic
908955094 1:69615284-69615306 CAAACCCGACCCTAGCTCCAAGG - Intronic
911224184 1:95286685-95286707 CAAAGCAGAGCCTGGCTCCCTGG - Intergenic
911856960 1:102890459-102890481 CAAAGGTGACCCTGGCTCCAAGG - Exonic
915482932 1:156199554-156199576 CAATGATTCCCCTGGCTCCATGG - Intronic
917235711 1:172889420-172889442 CATGGGTGACCTTTGCTCCATGG + Intergenic
917880383 1:179329931-179329953 CATAGCTGATACTGGCTCCATGG + Intronic
920392180 1:205614206-205614228 CAATGGTGCCCTTGGTTCCAAGG + Exonic
920922007 1:210305386-210305408 CACAGGCGACCCTGGCTGCTAGG + Intergenic
920939318 1:210466407-210466429 AAAAGGTGACCCTGGTTGGAAGG + Intronic
921844020 1:219860169-219860191 GGAAGGTGACCCTGGCTTCCAGG - Intronic
923036665 1:230289328-230289350 CACAGCTGACCTTAGCTCCAGGG - Intergenic
924374536 1:243391518-243391540 CACAGGTGACCCTGCCTGCTGGG - Intronic
1062872226 10:915266-915288 CAGAGCAGACCCTGTCTCCAGGG + Intronic
1064209180 10:13348452-13348474 AAAAGGTGGCCCGGGCGCCAAGG - Intergenic
1064716401 10:18181149-18181171 GCAAGGTGACCCTGGGTCAATGG - Intronic
1064922827 10:20537022-20537044 CAAAGATGAAGCTCGCTCCAGGG + Intergenic
1065018891 10:21486261-21486283 CAAAGTGGATCCTGTCTCCAGGG + Intergenic
1068272976 10:54753769-54753791 GAAAGGTGACCTCGGCACCAGGG + Intronic
1068877405 10:62011512-62011534 TATAGGTGACACTGGCACCAAGG - Intronic
1069907074 10:71738321-71738343 CAAAGGAGGCCCTGGGCCCATGG - Intronic
1070257324 10:74824425-74824447 CCAAGATGGCCCTGACTCCAGGG + Intergenic
1072203206 10:93179505-93179527 TAAAGGTCACTCTGGCACCAAGG + Intergenic
1072252030 10:93589288-93589310 CAAAGATTACCCTGGCTGCTGGG + Exonic
1073116235 10:101093461-101093483 AAAAGCTGGGCCTGGCTCCAGGG - Intronic
1073777464 10:106802246-106802268 ATAAGGTGAGCCTGGCTTCAGGG + Intronic
1074983101 10:118635201-118635223 CCAAGGTGACCCTGAGGCCAAGG + Intergenic
1075345509 10:121679298-121679320 CAAATGTGACCCTGGATCTCTGG - Intergenic
1075345705 10:121680648-121680670 CAAATGTGACCCTGGATCTCTGG - Intergenic
1075558990 10:123454781-123454803 CAAATCTGAGCCAGGCTCCATGG - Intergenic
1076219196 10:128719423-128719445 CAGAGGTGACCCTGGCTTGCAGG - Intergenic
1076594705 10:131618533-131618555 CCAAGGTGACCCTGGCACGTGGG + Intergenic
1076747008 10:132519560-132519582 CAAAGGTGAGCCTGCCCCGAGGG + Intergenic
1077026475 11:442112-442134 GGAAGGTGTCCCAGGCTCCAGGG - Intergenic
1077800547 11:5531716-5531738 TCAGGGTGACCCTGGCTCCTAGG + Intronic
1081549597 11:44099016-44099038 CAATGGAGACCCTGTCTCCAAGG - Intronic
1083065318 11:59917574-59917596 CAAAGGTGACTCTGGAGCAAAGG - Intergenic
1083420068 11:62547376-62547398 CACTGGTGACCCCGGCTCCTGGG - Intronic
1084653330 11:70501554-70501576 CAAAGGTGTCCCTGGCTCCATGG + Intronic
1087800539 11:102498567-102498589 AAATGGTGAGCCTGGCTACATGG - Exonic
1089544834 11:119215937-119215959 CAAAGCTGACGCTGGCTTCCAGG - Intronic
1091169169 11:133505337-133505359 AAAAGGTGAGCCTGGCTACCAGG + Intronic
1091646187 12:2274048-2274070 AAAAGGTGGCCCTGGGTCGAAGG + Intronic
1092261055 12:6953534-6953556 CAGGGGTGACACTGGCTCCTGGG - Intronic
1092438705 12:8476878-8476900 TAAAAGTTACCCTGCCTCCAGGG - Intronic
1095743762 12:45634874-45634896 CAGAGGTGACCCTCTCTCCTGGG + Intergenic
1095983794 12:47986843-47986865 CAAAGGTGAACAAGGCCCCAAGG - Exonic
1101496445 12:105259030-105259052 CAAATGTGAAGCTGGCTCTATGG + Intronic
1101707785 12:107236761-107236783 CCAAGGTTACCCAGGCTCCAGGG - Intergenic
1102164436 12:110795175-110795197 CAAGGGTGACCCTGACTGCCTGG - Intergenic
1102460949 12:113099342-113099364 CCAAGGTCTCCCAGGCTCCAAGG + Exonic
1102790708 12:115643050-115643072 CAAAGGTGTGCCTGGCTCCATGG + Intergenic
1103415712 12:120740480-120740502 CAAAGGTGCCCCTGAAGCCAAGG + Intergenic
1104647682 12:130508855-130508877 GAAAGGTGGCCCTGGCTCCTGGG + Intronic
1105655556 13:22433595-22433617 CAAAGGTCAGCATGGCTCCTGGG + Intergenic
1106782576 13:33074384-33074406 CCCAGGTGACCCTGACTCCTGGG + Intergenic
1108491898 13:50990661-50990683 CAAAGGCGACCAGGGCTCCCAGG - Intergenic
1108752342 13:53461042-53461064 CCAAGGTGCCACTGACTCCAAGG + Intergenic
1110542005 13:76717246-76717268 CAAGCATCACCCTGGCTCCAAGG + Intergenic
1113913349 13:113855221-113855243 CAAAGGTGAACTTGGGTCCAAGG - Intronic
1115050910 14:29061956-29061978 CAAAGGTGACCCCGGGTGTAAGG - Intergenic
1117459201 14:55927784-55927806 CAAAGGTGACCCATATTCCAGGG - Intergenic
1118480523 14:66160672-66160694 AAAAGATCACACTGGCTCCAGGG + Intergenic
1119300764 14:73569674-73569696 CAAAGGTTTCTCGGGCTCCAAGG - Exonic
1119407061 14:74405554-74405576 CCAAGGTGACTGAGGCTCCATGG - Intergenic
1120548963 14:85845897-85845919 AAAAAGTGACTCTGGCTCCTAGG + Intergenic
1121253825 14:92517411-92517433 CCTAGGTGACCCAGGCCCCAAGG - Intronic
1121505695 14:94474849-94474871 GAAAGGTCACCCTGTCTGCAGGG - Intronic
1121546072 14:94764678-94764700 CAAGGGGGACCCTGGCTGGAAGG - Intergenic
1122036173 14:98950721-98950743 CACAGGTGAGCCTGGCCACAGGG + Intergenic
1122043513 14:99007339-99007361 CAAACAGGCCCCTGGCTCCAGGG + Intergenic
1122141831 14:99667374-99667396 CATAGGTGCCCCTGGCAGCAGGG + Intronic
1122639544 14:103150289-103150311 CTAAGGAGACCCTCACTCCAAGG + Intergenic
1124240393 15:28023526-28023548 CACAGGGGACCCTGTCACCAGGG + Intronic
1126539062 15:49802472-49802494 CAGAGGTGCCCCGGGCTACATGG - Intergenic
1128308858 15:66617927-66617949 CCCAGGTGACGCTGGCTGCAGGG + Intronic
1129065921 15:72903761-72903783 CAAAGCTCAGCCTGGCTCCAGGG - Intergenic
1130085978 15:80779019-80779041 CACGGGCGACCCTGGCTCCTTGG + Intergenic
1130890905 15:88133137-88133159 CAAAAGTGACCTTTGGTCCATGG - Intronic
1133645349 16:7759170-7759192 CCAAGGTGGCCCTGGAGCCAAGG - Intergenic
1133874684 16:9722691-9722713 CAAAGGTGATCCTATCCCCAGGG - Intergenic
1135271473 16:21073429-21073451 CAAGGGTGACCCAGCCACCATGG - Intronic
1136640750 16:31563305-31563327 CTGAGCTCACCCTGGCTCCAGGG - Intergenic
1137706613 16:50539845-50539867 CAGAGGTGACGCTGCCCCCACGG - Intergenic
1137870518 16:51945863-51945885 CCAAGGTAACCCCTGCTCCATGG - Intergenic
1139256462 16:65547582-65547604 GAAAGGTCACTCTGGCTGCAGGG + Intergenic
1139512224 16:67434006-67434028 CCATGCTGATCCTGGCTCCATGG - Intronic
1139872577 16:70119297-70119319 CAAAGGTCAGTCTGGCTCCATGG - Intronic
1140363198 16:74362018-74362040 CAAAGGTCAGTCTGGCTCCATGG + Intergenic
1141779575 16:86150665-86150687 GAAAGGTAACCCCAGCTCCAGGG + Intergenic
1142320684 16:89380849-89380871 CAAAGGTGACCAGGCCTACACGG + Intronic
1143049921 17:4116692-4116714 CAAAGGTGACCCTGACCAGAAGG + Intronic
1143346588 17:6254004-6254026 ACCAGGTGACCCTGGCTCCTGGG + Intergenic
1143958815 17:10697511-10697533 CAAAGGAGACCCGGTCTCCGAGG - Exonic
1144384892 17:14740255-14740277 CAAAGGAGGCCCTGGCTGGAAGG - Intergenic
1144727223 17:17507941-17507963 CAAGGGTGACTCTCACTCCAGGG + Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146280566 17:31541691-31541713 GAGAGGGGACCCAGGCTCCAGGG - Intergenic
1146799190 17:35805135-35805157 CATTGGTGACCCCGGCTCCTTGG - Intronic
1147507711 17:41036341-41036363 AAAAGGTGACCAGGCCTCCATGG + Intergenic
1147567173 17:41544874-41544896 CCCAGGCCACCCTGGCTCCAAGG - Intergenic
1148106624 17:45122160-45122182 CAGAGGCCACCCTGGCTCCAGGG + Intronic
1149447673 17:56726175-56726197 CAAAGGAGACACTTGCTCCCAGG + Intergenic
1152585462 17:81187660-81187682 CGATGGTGACACTGGCTGCAGGG - Intergenic
1152645200 17:81465524-81465546 CTAAGGTTCCCCTGGCCCCACGG + Exonic
1154346457 18:13547431-13547453 CAAAGGTGCCACCGGCTACAAGG - Intronic
1159750807 18:72300220-72300242 CTAAGGTGACCCAGGCTCTAAGG + Intergenic
1159756289 18:72370450-72370472 CAATGGTGAACATGTCTCCAGGG + Intergenic
1160583907 18:79902339-79902361 CTAAGGTGGCCCAGGCTACAAGG + Intergenic
1161209420 19:3058494-3058516 CCAAGGGGACCCTAGCTTCATGG + Intronic
1162908926 19:13839356-13839378 TAAAGGGGACCCTGTCTCCTGGG - Intergenic
1164598150 19:29543694-29543716 CAAGGTACACCCTGGCTCCAAGG + Intronic
1164753869 19:30675348-30675370 CAAAGGTGTCCGTTGCTCTATGG + Intronic
1166997317 19:46725869-46725891 CAAAGGTGAGCCTGACCCCTTGG + Intronic
1167841551 19:52125717-52125739 CTAAGGTGTCCCTGCCTCCATGG + Intronic
1167845667 19:52162220-52162242 CAAAGGTGGCCCTGCTCCCAGGG + Intronic
926369345 2:12164249-12164271 CAAGAGTGACCCAGCCTCCACGG - Intergenic
926976234 2:18519568-18519590 CAAATGAGTCCCTGGCTCCCAGG - Intergenic
927200097 2:20572818-20572840 CACAGGTGGCCCCTGCTCCAGGG + Intronic
928310193 2:30203423-30203445 CCAAGGTGAGCCTGTCTCCTTGG + Intergenic
932572270 2:72944291-72944313 GAAGGGGGACCCTAGCTCCAGGG + Exonic
934147564 2:89110594-89110616 CAAAGGTGACCACAGCTGCATGG - Intergenic
934221706 2:90089997-90090019 CAAAGGTGACCACAGCTGCATGG + Intergenic
934232226 2:90194378-90194400 CAAAGGTGACCACAGCTGCATGG + Intergenic
935027517 2:99291622-99291644 CACAGGGGACCCTGGCTCAGGGG - Intronic
935140186 2:100346101-100346123 CAAAAATAACCCTGGCTGCAGGG + Intergenic
936042284 2:109159195-109159217 CAAAGCAGAGCCTGGCACCACGG - Intronic
940414923 2:153408527-153408549 CAAAAGGGACCCTGGCTCACTGG + Intergenic
942206201 2:173621987-173622009 CAAAGGTGACCCATGTTCAAGGG - Intergenic
944477970 2:200126169-200126191 CAATGGTGACAATGTCTCCAGGG - Intergenic
945686096 2:212972133-212972155 CAAAGGTGACCCTGCAACCATGG + Intergenic
946840740 2:223817235-223817257 CAAAAGTCAACCTGGCTCCAGGG + Intronic
947763747 2:232622550-232622572 CAAATCCGACCCAGGCTCCAGGG - Intronic
948454285 2:238097572-238097594 CAGTGGTGGGCCTGGCTCCAGGG + Intronic
948605537 2:239132336-239132358 CACACGTGACACTGGCTCCGAGG + Intronic
948883391 2:240871445-240871467 CACAGGTGAGCCTGGCCCCAGGG + Exonic
1171339903 20:24419692-24419714 CAAATATGACCCTGGCCTCATGG + Intergenic
1174863364 20:54113291-54113313 CATATGTGACCCTGGATCCTAGG - Intergenic
1175958440 20:62623082-62623104 CGGAGGTGGCCTTGGCTCCAGGG + Intergenic
1176163617 20:63661492-63661514 CATAGGTGACCCTAGTTCCCAGG + Exonic
1176230609 20:64030901-64030923 CTACGGTGCCTCTGGCTCCAGGG + Intronic
1179535656 21:42049817-42049839 CAGAGTTGACCCTGCCTCCTGGG + Intergenic
1181091115 22:20473197-20473219 CAAGGGTGACCCTGGCCCTGGGG + Intronic
1181180669 22:21065945-21065967 CACAGGTGGCCCTGCCTGCAGGG + Intergenic
1182482062 22:30615486-30615508 CCAGGGTGGCCATGGCTCCAGGG - Intronic
1183034004 22:35127027-35127049 CAAAGGAGAGCCTGGGTCAAAGG - Intergenic
1183324203 22:37182709-37182731 CAAAGGGGACCCAGGCCCAATGG - Exonic
1183476353 22:38038251-38038273 CAAAGCTGGTCCTGGTTCCAGGG - Intronic
1183777423 22:39975662-39975684 CAGAGGTGACCCCTGCTCCGTGG - Intergenic
1184471138 22:44697174-44697196 AACAGTTGATCCTGGCTCCAAGG + Intronic
950538303 3:13594615-13594637 CTAAAGTGATCCTGGCTCCGTGG + Intronic
951787631 3:26440009-26440031 CAAAGCTGACTCTGGGTCCAAGG + Intergenic
953023826 3:39133443-39133465 CCATGGTGAGCCTTGCTCCAAGG - Intronic
954133757 3:48572685-48572707 TAAAGGAGAACCTGGCCCCACGG - Exonic
954384798 3:50238386-50238408 AAAAGGTGAGCTGGGCTCCAAGG - Intronic
955113809 3:55976299-55976321 CCAAGGTGACTCTGGACCCAGGG + Intronic
957646838 3:82940333-82940355 CAAAGATGAGCCAGGCCCCAAGG - Intergenic
958925272 3:100150224-100150246 CAAAAGAAACCCTGGCCCCAAGG - Intronic
960157287 3:114308879-114308901 CAAAGAAGGCCCTGGCACCAAGG + Exonic
961552861 3:127679055-127679077 CAAAGGTAACCCCTGCTACAGGG - Intronic
961740607 3:129031111-129031133 TAAAGGTGACCCTGGCCACCTGG - Intronic
962688105 3:137866844-137866866 CAGAGGTGACCCTGCCCCCATGG + Intergenic
966585703 3:181621496-181621518 CAAATCTGACCCTGGCTCCTAGG - Intergenic
966849574 3:184156148-184156170 AAAAGGTGGCTCTGGCTCCTCGG - Intronic
968075060 3:195811826-195811848 CAAAAGTCCCCCTGGCTCCCTGG + Exonic
969245768 4:5931782-5931804 TAAAGGAGAGCCTGGATCCACGG - Intronic
969571464 4:8011142-8011164 CAGAGGTCAGCCTGGCTTCAGGG + Intronic
969714365 4:8861209-8861231 CAGGGATGAACCTGGCTCCAGGG + Intronic
970438705 4:16060934-16060956 CAAAGGTGACAAGGGCTCCTGGG - Intronic
972000928 4:34031482-34031504 GAAAGGTCATCCTTGCTCCAGGG - Intergenic
973795164 4:54417901-54417923 CAGAGGCCACCCTGGCTCCAGGG + Intergenic
973830900 4:54757751-54757773 AAAAGGTCACCCTGGTTACAAGG + Intergenic
974610520 4:64209789-64209811 CCTAGGTGATCCTGCCTCCATGG - Intergenic
975516112 4:75250136-75250158 CAAAGGTAACCCTGCCACCCTGG - Intergenic
984867406 4:184293720-184293742 CAATGGTTACCGTGGCTGCAAGG + Intergenic
985650547 5:1105350-1105372 CAAAGGGGACCCTCCCTGCAGGG + Intronic
985675077 5:1226762-1226784 CAGAGGCGTCCCTGGCTCCCGGG + Intronic
986699604 5:10393089-10393111 CCCAGGTGACCTTGGCTCAAAGG - Intronic
987222185 5:15802250-15802272 CAAAGGTCACACTGGCTACTGGG - Intronic
988622418 5:32836466-32836488 CAGAGCTGACTCTGGCTTCAAGG - Intergenic
993740339 5:91530863-91530885 CTAAAGTAACCATGGCTCCAGGG + Intergenic
996252175 5:121348816-121348838 GAAAGATGTCCCTGCCTCCAGGG + Intergenic
997621853 5:135304382-135304404 CACAGATCACCCTGGTTCCATGG + Intronic
998454347 5:142259779-142259801 CAAAGATGACCCTGGCTGCTGGG - Intergenic
998731310 5:145080681-145080703 ACCAGGTGACCCTGACTCCAGGG + Intergenic
999393854 5:151214128-151214150 TAAAGCTGACCCTGGCATCAGGG - Intronic
999499449 5:152132213-152132235 CAAGGGTGACCCTGCCTCCATGG + Intergenic
999692182 5:154157730-154157752 CAGAGGTGAGCCTGGCTTCATGG + Intronic
1001024899 5:168215791-168215813 CAGAGGAAATCCTGGCTCCATGG + Intronic
1001411875 5:171518038-171518060 CCTTGGTCACCCTGGCTCCAAGG + Intergenic
1001772463 5:174306468-174306490 CAAGGGTGACTCTGGCTGGATGG + Intergenic
1002424774 5:179168439-179168461 CAGTGAGGACCCTGGCTCCAGGG - Intronic
1003097680 6:3155516-3155538 CCAAGGTGACACTGTGTCCACGG - Intronic
1003101364 6:3178823-3178845 CCAAGGTGACACTGTGTCCACGG - Intergenic
1006355507 6:33554751-33554773 AAAAGGAGACCCTGTCTCTAAGG - Intergenic
1007227471 6:40325224-40325246 CATGGGTGGCCCTGGCTCCCAGG - Intergenic
1008358549 6:50586440-50586462 TAAAGTTGGCTCTGGCTCCAGGG - Intergenic
1010563251 6:77376879-77376901 TAAAGGTAACTCTGGCTCAAGGG + Intergenic
1010579792 6:77581559-77581581 CAATGGTGAAACTGCCTCCATGG + Intergenic
1011755443 6:90494231-90494253 CAATGGTGACCAAGGCTCCCTGG + Intergenic
1012476369 6:99618770-99618792 CAATAGCAACCCTGGCTCCAAGG - Intergenic
1012658566 6:101857162-101857184 CAAATGTGCCTCTGTCTCCAAGG + Intronic
1014913671 6:127120339-127120361 CAGGGGCGACCCTGGCTCTATGG + Intronic
1017539410 6:155385116-155385138 CAAAGGTGACCCAGGATCTGGGG - Intergenic
1018850878 6:167589355-167589377 CACAGGTGAGCCTGCCTGCATGG + Intergenic
1019741739 7:2678440-2678462 CTAGGGTGACCCAGGCTCCATGG + Intergenic
1019797789 7:3064553-3064575 AAAAGGTGTCCCTGCCTCCTGGG - Intergenic
1019906756 7:4070685-4070707 GAGAGGTGGCACTGGCTCCAAGG - Intronic
1020020571 7:4864865-4864887 AAAAGATGACTCTGGCTCCTAGG - Intronic
1020246416 7:6432819-6432841 CCCAGGTGAGCCTGGCTTCATGG - Exonic
1020674592 7:11166270-11166292 GAAAGAAGACCCTGGCTACATGG - Intronic
1022898853 7:34781734-34781756 CCAGGGTGGCCATGGCTCCAGGG - Intronic
1023083710 7:36549052-36549074 CAAAGTTGACTATGGGTCCACGG - Intronic
1023891246 7:44393394-44393416 CCTAGGTGACCCTGGCTGCTTGG + Intronic
1025198448 7:56948718-56948740 CCGAGGTGACCCTGGATCCCAGG + Intergenic
1025673503 7:63628215-63628237 CCGAGGTGACCCTGGATCCCAGG - Intergenic
1027052790 7:75030394-75030416 GAATGCAGACCCTGGCTCCAGGG + Intronic
1028111924 7:86950802-86950824 CAAAGGTGCCACTGGCCACAGGG + Intronic
1028753452 7:94408802-94408824 CCCAGGTGCCCCTGGCCCCAAGG + Exonic
1029123945 7:98284898-98284920 CAAGGGAGAACCTGGCTTCAGGG - Intronic
1029169504 7:98620721-98620743 CACAGGTGAGCGTGGCTCCGTGG + Intronic
1029629065 7:101739253-101739275 AAAAGGTTACTCTGGCTGCAGGG + Intergenic
1030085235 7:105810273-105810295 CCCAGGTCTCCCTGGCTCCAAGG - Intronic
1032019923 7:128401674-128401696 AAAAGGTCACTCAGGCTCCAAGG + Intronic
1032237728 7:130139899-130139921 CTAAGGTGACACAGGCTGCATGG - Intergenic
1033424596 7:141232732-141232754 GAAAGCTTTCCCTGGCTCCATGG + Intronic
1034269930 7:149798497-149798519 GAAAGGGGGGCCTGGCTCCATGG - Intergenic
1036550698 8:9812976-9812998 CAAAGGTGATCCTGAATGCATGG + Intergenic
1036605025 8:10297014-10297036 CAAAGGTGACATTTTCTCCACGG + Intronic
1036663281 8:10722092-10722114 CAAAGATGCCCCTGGCTCCTGGG + Intergenic
1037113458 8:15194716-15194738 CAAAGGCGGCCTTGGCTCCCTGG - Intronic
1040560884 8:48522653-48522675 CAAAGGTGACCCTGACTCCCAGG + Intergenic
1041447668 8:57970627-57970649 CAGAGGTGACACTGGCCTCAAGG + Intergenic
1042292323 8:67182016-67182038 CAAGGGTGACCCTGTCTCTAAGG - Intronic
1045965442 8:108019459-108019481 CAAAGCTGACCCATTCTCCAAGG + Intronic
1047960611 8:130009143-130009165 CAAAGATCTCCTTGGCTCCAAGG + Intronic
1047966895 8:130051566-130051588 CACAGGTGGTTCTGGCTCCAAGG - Intergenic
1048208089 8:132431568-132431590 CTCAGGTGAGCCAGGCTCCATGG - Intronic
1049373498 8:142278622-142278644 CAAGGGTGACGCTGGCTCTGAGG - Intronic
1049385184 8:142339570-142339592 CAGAGGTGACCCTGTCTCCCTGG - Intronic
1051874297 9:21775290-21775312 CAAATGTGAGCCAGGCACCATGG + Intergenic
1052454244 9:28674178-28674200 CAAACGTGACCCTAACTTCAAGG + Intergenic
1053276938 9:36790324-36790346 CAAATCTTAGCCTGGCTCCAGGG - Intergenic
1057900136 9:98942376-98942398 CAATGCTGGCCCTGGCTGCAGGG - Intergenic
1059354059 9:113686311-113686333 AAAAGGCCACCCTGACTCCATGG + Intergenic
1059438713 9:114290824-114290846 CGATGGGGACCCTGGCCCCATGG + Exonic
1059529291 9:115021018-115021040 CAAAGCTGACCATGGATCCCTGG - Exonic
1059877886 9:118656366-118656388 CAAAAGTCTCCCTTGCTCCAGGG + Intergenic
1060265080 9:122107342-122107364 CAAAGGTCACCCTGGCTAAGAGG - Intergenic
1060714802 9:125915407-125915429 AAAAGGTAACCCTGGCTTCCTGG - Intronic
1061488131 9:130930608-130930630 CACAGGTGACCGTGGGTCCCTGG - Intronic
1061649949 9:132039605-132039627 CAAAGGCCACACTGGATCCAAGG + Intronic
1061847312 9:133394953-133394975 CCAAGGTCACTCTGGCTGCAGGG + Intronic
1061961123 9:133989883-133989905 CAAAGGTGGCCCACCCTCCACGG + Intronic
1062280366 9:135749175-135749197 CACAGGAGACCCTGCGTCCAAGG + Intronic
1188472595 X:30557354-30557376 GAAGGGTCACCCTAGCTCCAGGG + Intergenic
1190797810 X:53760514-53760536 CCAAGATGGCCCTGGCTGCAGGG - Intergenic
1190917351 X:54820696-54820718 CCAAGATGGCCCTGGCTGCAGGG + Intergenic
1191740799 X:64433847-64433869 CTGAGGGGACCCTGGTTCCAAGG + Intergenic
1192168200 X:68839083-68839105 CCAAGCTCACCTTGGCTCCAGGG + Intronic
1195751454 X:108164672-108164694 GAGAGGTGAGCCTGGCTTCATGG - Exonic
1198156894 X:133969667-133969689 CAAAGGTTTCTCTGACTCCATGG + Intronic
1198507568 X:137316675-137316697 CAAAGATGAGCCTGGAGCCAGGG - Intergenic