ID: 911858160

View in Genome Browser
Species Human (GRCh38)
Location 1:102908876-102908898
Sequence GTCTAGTTAGAAATACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911858160 Original CRISPR GTCTAGTTAGAAATACTGGC AGG Intronic
901247181 1:7741265-7741287 TGCTAGTTAGAAATGTTGGCCGG + Intronic
902683321 1:18058988-18059010 CTCTAATTAGAAAGGCTGGCAGG + Intergenic
903194621 1:21675985-21676007 CTGTAGGCAGAAATACTGGCTGG - Intergenic
908732040 1:67236125-67236147 GTCTAGTTATAAAGGCTGTCAGG - Intronic
911858160 1:102908876-102908898 GTCTAGTTAGAAATACTGGCAGG + Intronic
916995646 1:170296348-170296370 TTCTAGTTCCAAAGACTGGCAGG - Intergenic
918323381 1:183385899-183385921 GTCTATTTAGAAAGACAGACAGG + Intronic
921577554 1:216854403-216854425 GTCTAGTTAGAAATACATCTAGG - Intronic
1066258642 10:33706552-33706574 ATCTAGTTAGAAATACCTACTGG - Intergenic
1078118405 11:8479982-8480004 ATTTAGTTAGAAAAACAGGCAGG + Intronic
1078367141 11:10716064-10716086 GTCTAGTTAGGAAGACAGCCTGG + Intergenic
1078441631 11:11373040-11373062 GTCTACTTAGAAAGATTAGCTGG + Intronic
1078831171 11:14978693-14978715 GCCTAGTTAGAAAAGCTGGTGGG - Intronic
1079597205 11:22264615-22264637 TTCTAGTTAGAAATATCAGCTGG - Intronic
1079608596 11:22401978-22402000 TTCTATTTAGAAATGCAGGCCGG + Intergenic
1085811435 11:79685968-79685990 GTGTGGTTAGAAATATAGGCAGG - Intergenic
1086498326 11:87426553-87426575 GTCTAGTGGGAAAGACAGGCTGG + Intergenic
1087982721 11:104636170-104636192 GTCTAATTAGAACTACTGTTGGG + Intergenic
1088386531 11:109264213-109264235 GTCCACTCAGAAATGCTGGCTGG - Intergenic
1088629427 11:111760308-111760330 GAGTAGCTAGAAATACAGGCGGG + Intronic
1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG + Intronic
1089955089 11:122563081-122563103 GGCTATTTAGAAATACTGACAGG + Intergenic
1091907893 12:4203827-4203849 GTGAAGTTAAAAATACTGACAGG + Intergenic
1092080004 12:5708102-5708124 GTCTAGTTTGAACAACTGGTAGG - Intronic
1094146001 12:27228902-27228924 GTTTAGTTAAATATATTGGCAGG - Intergenic
1095961596 12:47838374-47838396 GGCTGGTTAGAAACACTGGAAGG + Intergenic
1098856695 12:75660915-75660937 GTCTGGTTAGAAATGATGGTGGG - Intergenic
1100521134 12:95377078-95377100 GCCTAGTTAGAAATCCTACCAGG - Intergenic
1101050136 12:100853937-100853959 GTCTACCTAGAACTACTGACTGG - Intronic
1110912319 13:80980422-80980444 CATTAGTTAGAAATATTGGCTGG + Intergenic
1111643504 13:91000951-91000973 TTCAAGTTAGAAATACTAGGTGG - Intergenic
1111843364 13:93477091-93477113 GACTAGTTATAAATACTGTTGGG + Intronic
1119799010 14:77426080-77426102 GTCTATTTAAAAAAACAGGCCGG + Intergenic
1123540842 15:21288952-21288974 GTTTATTTAAAAATATTGGCCGG + Intergenic
1123978601 15:25577654-25577676 GTCAAGGTACAAATACTTGCCGG - Intergenic
1125416181 15:39455517-39455539 ATCTAGTTCCAAATACTGGAGGG + Intergenic
1128058075 15:64715504-64715526 GTTTAGTTAAAAAAACTGGCTGG - Intergenic
1128447726 15:67779097-67779119 TTGCAGTGAGAAATACTGGCTGG + Intronic
1128471361 15:67956485-67956507 GGCAAATGAGAAATACTGGCAGG + Intergenic
1129017595 15:72482130-72482152 GTCTATTTGAAAATACTGGCCGG - Intronic
1130834446 15:87635478-87635500 TTCTTGTTAGAAACACTGGCTGG - Intergenic
1202949155 15_KI270727v1_random:16094-16116 GTTTATTTAAAAATATTGGCCGG + Intergenic
1133497661 16:6335031-6335053 ATTTAGTTAGAAATACTAACAGG - Intronic
1135474931 16:22765596-22765618 GTAAAGTCAGAAATTCTGGCAGG + Intergenic
1142956988 17:3529121-3529143 GTCTGGTTGGAAATGCTGGGAGG + Intronic
1143813418 17:9491130-9491152 GTCTAATTAGAGATGCCGGCGGG - Intronic
1148703134 17:49603743-49603765 GTCTAGTTGGAAATTCTGAATGG + Intronic
1152997516 18:421767-421789 GTCTATTTGAAAACACTGGCAGG - Intronic
1156358456 18:36362512-36362534 GGCTAGTGAGAAATGTTGGCTGG + Intronic
1160616992 18:80137928-80137950 GTCTACTTGGCAATCCTGGCTGG + Exonic
1161729188 19:5948527-5948549 GGCAAGTTAGAAAACCTGGCTGG + Intronic
1166512150 19:43416152-43416174 GTCCAGTTAAACATATTGGCTGG - Exonic
929633101 2:43486810-43486832 ATCTATTTTGAAATGCTGGCAGG + Intronic
941913893 2:170795272-170795294 TTCTAATTTGAAATTCTGGCTGG - Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
944622523 2:201531261-201531283 GTTTAGTTAAAAATACTGCAGGG - Intronic
1170021470 20:11841057-11841079 TTGTAGTTAGAAATTCAGGCAGG + Intergenic
1173241914 20:41304389-41304411 ATCCAGGTGGAAATACTGGCAGG - Intronic
1178151523 21:29799828-29799850 GTCTGTTTAAAAAAACTGGCTGG - Intronic
1180061876 21:45389688-45389710 TTCTAGTTAGAAAATGTGGCCGG - Intergenic
1182880774 22:33731302-33731324 TTCTACTTAGAAATGCAGGCCGG - Intronic
957234878 3:77574165-77574187 ATAAAGTTAGAGATACTGGCAGG + Intronic
959496165 3:107054678-107054700 CTCTAGTTAGAAAACTTGGCTGG - Intergenic
961568028 3:127777494-127777516 GCTTACTTAGAAATCCTGGCAGG - Intronic
969555047 4:7902088-7902110 GACTGGTTAGAAATCATGGCAGG - Intronic
971951465 4:33354663-33354685 GTCTTCTTAGAAATACTTGAAGG + Intergenic
977207986 4:94185234-94185256 TTCTTGTTAGAAATACTTTCTGG - Intergenic
978095074 4:104766280-104766302 GTTCAGTGAGAAAAACTGGCAGG - Intergenic
978927125 4:114260676-114260698 GAGTAGTTAGAAATACAGGCAGG + Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981152086 4:141390940-141390962 GTGTTGATAGAAATACTGACAGG - Intergenic
984698734 4:182804810-182804832 GAGGAGCTAGAAATACTGGCAGG - Intergenic
987325083 5:16805164-16805186 GTGTGGTAAGAAATTCTGGCTGG + Intronic
992626492 5:78640433-78640455 ATATAGTTATAAATACTGGAAGG - Intronic
993211197 5:84953680-84953702 GTCAGGGTAGAAATATTGGCTGG + Intergenic
993814999 5:92532615-92532637 GTATAGTCAGAAAAACTGGAAGG - Intergenic
998446222 5:142200480-142200502 GTCTATGTAGAAAGACTGCCTGG + Intergenic
998872277 5:146564454-146564476 TTCTACTAAGAAATACAGGCTGG + Intergenic
999229102 5:150051183-150051205 GACTGGTGAGAAATACTGTCTGG - Intronic
1001610344 5:172995908-172995930 CTCTAGAAAGAAATCCTGGCTGG - Intronic
1003870122 6:10395846-10395868 GTCTAGGTAGACAGACTGGTAGG - Intronic
1006579390 6:35068019-35068041 GTGTAGCTGGAATTACTGGCGGG + Intronic
1009507636 6:64504803-64504825 GGCTAGTAAGAAACACTAGCAGG + Intronic
1010443575 6:75926817-75926839 GTATAGTTACAAATATTGGATGG + Intronic
1011634465 6:89358199-89358221 GTCTAGGTACAGATGCTGGCTGG + Intergenic
1013251776 6:108341599-108341621 ATCTAGGTACAAATCCTGGCTGG - Intronic
1016938858 6:149468389-149468411 GTCTAGTTACTGAAACTGGCTGG - Intronic
1021258083 7:18419519-18419541 GTCTGGAGAGAAATACTGCCAGG - Intronic
1021833221 7:24639596-24639618 GTTTAGATAGAAATATTTGCTGG - Intronic
1031177798 7:118374761-118374783 CATTAGTTAGAAATATTGGCCGG + Intergenic
1032853236 7:135813050-135813072 GTCCAGTTGGAAACACTGACAGG + Intergenic
1041626210 8:60030164-60030186 GTCTAGTTCCAAATACTATCTGG + Intergenic
1044870073 8:96610854-96610876 GTCTAGGTAGAGATATTGGAAGG + Exonic
1045398155 8:101782910-101782932 GTCTAGTTAGGAAGGCTGGATGG - Intronic
1046819234 8:118618384-118618406 TACTAATTAGAAAAACTGGCTGG + Intronic
1047456708 8:125020403-125020425 GCTTAGTTAGAGATACTGGTTGG + Intronic
1048469796 8:134696094-134696116 GTTTGGTTAGAAATGCGGGCAGG - Intronic
1048837497 8:138535250-138535272 GCCTGGTTGGAAATAATGGCAGG - Intergenic
1052744760 9:32429630-32429652 GTTTAGTTAAAATTACTAGCTGG + Intronic
1053337171 9:37286363-37286385 GTTAAATTAGAAATACAGGCTGG + Intronic
1059545378 9:115170743-115170765 GTCTATTAAGAAATACTGAAAGG - Intronic
1187839391 X:23471185-23471207 GGCCAGTAAGAAACACTGGCAGG + Intergenic
1192126133 X:68502618-68502640 GTTTAGTTTGAGATACTGGCAGG + Intronic
1195614919 X:106904310-106904332 TTCTAGTTACAACTACTGGCAGG + Intronic
1197509918 X:127358238-127358260 GTCAACTTAAAAATATTGGCTGG - Intergenic
1199789695 X:151141127-151141149 GTCTAGTTCTAAATACTTGAGGG + Intergenic