ID: 911861880

View in Genome Browser
Species Human (GRCh38)
Location 1:102961909-102961931
Sequence CACTTTTCCCAGGGTGCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911861880_911861884 22 Left 911861880 1:102961909-102961931 CCAGGTGCACCCTGGGAAAAGTG 0: 1
1: 0
2: 0
3: 15
4: 208
Right 911861884 1:102961954-102961976 CATATGAATTGAATACCAATAGG 0: 1
1: 0
2: 0
3: 11
4: 166
911861880_911861885 25 Left 911861880 1:102961909-102961931 CCAGGTGCACCCTGGGAAAAGTG 0: 1
1: 0
2: 0
3: 15
4: 208
Right 911861885 1:102961957-102961979 ATGAATTGAATACCAATAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911861880 Original CRISPR CACTTTTCCCAGGGTGCACC TGG (reversed) Exonic
900425333 1:2575818-2575840 GACTTTTCCCAGGGTGGGGCCGG - Intergenic
902731765 1:18374424-18374446 CATTGTTCCCATGGTGCACTTGG + Intronic
904428443 1:30446694-30446716 GACTTTTCCTGGGCTGCACCAGG + Intergenic
905257532 1:36694545-36694567 CACTCTTCTCAGGGTGCAGTGGG - Intergenic
905280231 1:36844349-36844371 CACTTTTCCCAGGCCCCACGTGG - Intronic
905462764 1:38132320-38132342 CACTTTTCCTAGGCTCCTCCAGG - Intergenic
906091292 1:43181472-43181494 CACTTTCACCAGGGTTCAACAGG - Intronic
908463180 1:64366283-64366305 CACCTTTCCCAGGGAGAAGCAGG + Intergenic
911861880 1:102961909-102961931 CACTTTTCCCAGGGTGCACCTGG - Exonic
915671816 1:157495536-157495558 CACTTGACCCAAGTTGCACCTGG + Intergenic
1065668115 10:28084738-28084760 CACATTTCCCATGGTCAACCTGG - Intronic
1065790734 10:29258053-29258075 CAGTTTTCCCAGGCTGCTCAGGG + Intergenic
1065826249 10:29574513-29574535 CAGTCTTACCAGGGTCCACCAGG - Intronic
1065951124 10:30652105-30652127 CAGTCTTCCCAGGGTCCACCTGG + Intergenic
1067966380 10:50917811-50917833 AACCTTTCCCAGAGTGCCCCAGG + Intergenic
1069135234 10:64755464-64755486 CACTTTTCCCAGGATGCAAATGG + Intergenic
1069631491 10:69899781-69899803 CACCTTTCTCATGCTGCACCAGG + Intronic
1070165107 10:73891522-73891544 CACTTTTCCCAGAGTTCTCCAGG - Intergenic
1072622184 10:97087381-97087403 CACTTTTCCCCGTGGTCACCAGG + Intronic
1072810420 10:98457370-98457392 CCCATTTCCCCGGGTGCCCCTGG + Intronic
1073458490 10:103652048-103652070 CTCATTTCCCATGGTGCTCCTGG + Intronic
1075623969 10:123948468-123948490 CAGTTTTCCCATGGTGACCCTGG - Intergenic
1077409111 11:2395315-2395337 CACTTTTCCCAGGCTCTCCCTGG - Intronic
1077506942 11:2933952-2933974 CACTTTCCTCAGGCTGCAGCTGG - Intergenic
1077581521 11:3420399-3420421 CAGATGTCGCAGGGTGCACCTGG + Intergenic
1080210553 11:29780595-29780617 ACCTTTCCCCAGGGTGCATCTGG + Intergenic
1080600493 11:33817478-33817500 CACTTCTCCTGGGATGCACCAGG - Intergenic
1081178237 11:39955266-39955288 CATTTTCCTCAGGTTGCACCAGG + Intergenic
1082006396 11:47421613-47421635 CATTTATCCCAGGGAGCAACAGG + Intronic
1084303114 11:68264267-68264289 CACCTGTCACAGGGTGCACATGG - Intronic
1084833975 11:71789608-71789630 CAGATGTCGCAGGGTGCACCTGG - Intronic
1085478820 11:76805298-76805320 CACCTTTCCCAGGGTCCTCTGGG - Intergenic
1088418880 11:109620293-109620315 CAGTTTGCCCAGGGTTCAGCAGG - Intergenic
1088830623 11:113533258-113533280 CACCTTTCCCACGGTACACTAGG + Intergenic
1089322434 11:117635511-117635533 TCCATTTCCCAGGGTGCAGCAGG + Intronic
1090731958 11:129580093-129580115 CACTTGTCCAAGGTTGCAGCAGG + Intergenic
1092409126 12:8240858-8240880 CAGATGTCGCAGGGTGCACCTGG + Intergenic
1093087849 12:14886429-14886451 CATTTTTCCAAGGGTTCATCAGG + Intronic
1097269333 12:57764784-57764806 CACATTTCCCAGGATGGACTGGG + Exonic
1097680621 12:62645876-62645898 GACTTTTCCAGGGATGCACCAGG + Exonic
1099285864 12:80713939-80713961 CTCTTTTCCCAGGGGAGACCTGG - Intergenic
1102251102 12:111388124-111388146 CTCTCTTCCCAGAGTGCGCCAGG + Intergenic
1103054106 12:117805076-117805098 CAGTTTACCCAGGGTGTTCCTGG - Intronic
1103296771 12:119893597-119893619 CAGTTCTCCCGGGGTGGACCAGG - Intergenic
1103875200 12:124121724-124121746 CACTTTTCCCAGCCAGCAGCTGG + Intronic
1103951840 12:124555619-124555641 CACCATTCCCAGAGTTCACCAGG + Intronic
1104828926 12:131734718-131734740 GACTTCTCCCAGGAAGCACCAGG - Intronic
1106703791 13:32258815-32258837 CACTTTGCCCAGGATGATCCCGG - Intronic
1112703443 13:102038431-102038453 AACATTTTCCAGGGAGCACCCGG + Intronic
1113866418 13:113528602-113528624 CAGTCTTCCCACGGTCCACCAGG - Intronic
1114066285 14:19062098-19062120 CCCTTTGCCTAGGGAGCACCCGG - Intergenic
1114095983 14:19337926-19337948 CCCTTTGCCTAGGGAGCACCCGG + Intergenic
1114112824 14:19488615-19488637 CACTTTTCCCAGAGGCCACTAGG + Intergenic
1115331557 14:32203497-32203519 CCCTTTACCCAGGGTGCCCCGGG - Intergenic
1121631046 14:95422215-95422237 CACTGTGCCCATGGTTCACCAGG + Intronic
1121877191 14:97464214-97464236 CAATTTTCCTAGGGTGCAGCAGG - Intergenic
1123552655 15:21397978-21398000 CACCTTTGCAGGGGTGCACCGGG - Intergenic
1123553086 15:21400539-21400561 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123553192 15:21401169-21401191 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123588902 15:21835366-21835388 CACCTTTGCAGGGGTGCACCGGG - Intergenic
1123589116 15:21836647-21836669 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123589331 15:21837927-21837949 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1123589438 15:21838557-21838579 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1125716350 15:41821988-41822010 CACTCTTCCCAGAGTTCCCCGGG - Exonic
1125994469 15:44144584-44144606 CACTTAGCTCAGGGTGCCCCTGG - Intronic
1127713704 15:61626630-61626652 CACTTTTCCCAGGGGGATCCAGG + Intergenic
1128847724 15:70916698-70916720 CACTTGTCCCCAGGTCCACCTGG - Intronic
1129066916 15:72912790-72912812 GACTTTTCCCAGCCTTCACCTGG - Intergenic
1131368219 15:91857302-91857324 CAGTTGGCCCAGGTTGCACCTGG - Intronic
1202961005 15_KI270727v1_random:125198-125220 CACCTTTGCAGGGGTGCACCGGG - Intergenic
1202961219 15_KI270727v1_random:126479-126501 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961434 15_KI270727v1_random:127759-127781 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961541 15_KI270727v1_random:128389-128411 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1202961601 15_KI270727v1_random:128804-128826 CACCTCTGCAAGGGTGCACCTGG + Intergenic
1133087783 16:3378526-3378548 CAGGTTTCCCAGGGTGCAGAGGG - Intronic
1133350091 16:5095667-5095689 CAGATGTCGCAGGGTGCACCTGG + Intronic
1135470817 16:22728949-22728971 TACTTTTCCCAGGGTGACCTGGG + Intergenic
1142766031 17:2064867-2064889 TAGTTGGCCCAGGGTGCACCTGG + Intronic
1143258452 17:5581671-5581693 CACTGTTTCCAGGAGGCACCTGG - Intronic
1143735832 17:8911543-8911565 CTCCTTTCCCAGAGAGCACCTGG + Intronic
1146553168 17:33799594-33799616 CAGTGATCCCAGTGTGCACCTGG + Intronic
1147952274 17:44113873-44113895 CACTTCATCCAGGGTGCTCCTGG - Intronic
1148232029 17:45942331-45942353 GGCTTCGCCCAGGGTGCACCAGG + Intronic
1152347244 17:79760661-79760683 CTCTATTCCCAGGGCGCTCCTGG + Intergenic
1152378829 17:79931738-79931760 GGCATTTCCCAGGGGGCACCTGG + Intergenic
1152698227 17:81806730-81806752 CATTTTGCCCAGGGAGCTCCTGG + Intronic
1154064372 18:11093197-11093219 CGCTTTACCCAGGATGCACAGGG - Intronic
1154453878 18:14503286-14503308 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1155177075 18:23310261-23310283 TCCTTTCCCCAGGATGCACCTGG - Intronic
1157479398 18:48043927-48043949 CGCTTTACCCAGGGTGAACAGGG + Intronic
1159594596 18:70370809-70370831 CAGTTCTTCCAGGGTGCACATGG + Intergenic
1159988576 18:74874928-74874950 CTCTTCTCGCAGGGTTCACCCGG + Intronic
1160605540 18:80046811-80046833 CACTTTTCCCTTGGTGCCCGTGG + Intronic
1161566346 19:5004906-5004928 CACTTTGCCCGGGATGCTCCTGG - Intronic
1162864715 19:13536778-13536800 CAAATTTCACAGGGAGCACCGGG - Intronic
1164691432 19:30213591-30213613 CACATTTCCCACTGTGCCCCGGG - Intergenic
1164942981 19:32265995-32266017 CATTCTTTCCAGGGGGCACCTGG + Intergenic
1165095361 19:33407083-33407105 CACGTGTCCCAGGATGCCCCAGG - Intronic
1165690936 19:37862615-37862637 CAGTTTTCCCAGGCTGGAGCTGG + Intergenic
1166105545 19:40596501-40596523 CTCTGCTCCCAGGGTGCTCCTGG - Intronic
1168503125 19:56910170-56910192 CATCTTTCCCAGGGTGAACAGGG + Intergenic
927104457 2:19811415-19811437 CACTCTTCCCTGAGCGCACCAGG - Intergenic
928165469 2:28968531-28968553 CACTTTTCCTAGGGTGCATATGG - Intronic
928696351 2:33853580-33853602 CAGTGTTCCCAGGCTGCACAGGG + Intergenic
933599682 2:84316893-84316915 GATTTTTCCCATGGTGCAACTGG - Intergenic
933700994 2:85255505-85255527 CAGCTTTCCCAGGGAGCCCCAGG + Intronic
933976270 2:87514631-87514653 CACATTTCCCCGAGGGCACCTGG + Intergenic
936317552 2:111436175-111436197 CACATTTCCCCGAGGGCACCTGG - Intergenic
937113670 2:119387627-119387649 TACTTCTGCCAGGGTGCAGCAGG + Intergenic
937124191 2:119462782-119462804 CACTGTCCCCAGGCAGCACCGGG - Intronic
938280955 2:130063330-130063352 CACTTCTGCAAGGGTGCGCCAGG + Intergenic
938331600 2:130452166-130452188 CACTTCTGCAAGGGTGCGCCAGG + Intergenic
938357863 2:130666410-130666432 CACTTCTGCAAGGGTGCGCCAGG - Intergenic
938358351 2:130669340-130669362 CACTTCTGCAAGGGTGCGCCAGG - Intergenic
938358544 2:130670509-130670531 CACTTCTGCAAGGGTGCGCCAGG - Intergenic
938434250 2:131272970-131272992 CACCTCTACAAGGGTGCACCTGG + Intronic
938434572 2:131274960-131274982 CACCTCTACAAGGGTGCACCTGG + Intronic
947727668 2:232410011-232410033 CTCGGTCCCCAGGGTGCACCGGG - Exonic
948899506 2:240949279-240949301 CACCCTGCCCAGGCTGCACCTGG + Intronic
1169466390 20:5844556-5844578 TACTTTGCAGAGGGTGCACCAGG + Intronic
1170775982 20:19375013-19375035 CAGTTATCCCTGGGTGTACCTGG - Intronic
1170841803 20:19930027-19930049 CACTTGTCCCAGAGTGCAGAGGG - Intronic
1172425155 20:34851079-34851101 CACATTGCCCAGGATGCGCCTGG + Intronic
1172890595 20:38260962-38260984 CGCTCTTCCCACGGCGCACCCGG + Intronic
1174264015 20:49318582-49318604 TGCCTTTCCCCGGGTGCACCTGG - Intergenic
1176602650 21:8807223-8807245 CAACTTTCCCAGGCTACACCTGG + Intergenic
1176820291 21:13650010-13650032 CACCTCTGCAAGGGTGCACCTGG + Intergenic
1176820402 21:13650649-13650671 CACCTCTGCAAGGGTGCACCTGG + Intergenic
1176820611 21:13651930-13651952 CACCTTTGCAGGGGTGCACCGGG + Intergenic
1178049155 21:28729558-28729580 CTCTTTTTCCAGTGTGGACCAGG - Intergenic
1179417354 21:41209086-41209108 CAGTCCTCCCAGGGTGCACATGG - Intronic
1180344935 22:11698780-11698802 CAACTTTCCCAGGCTACACCTGG + Intergenic
1180484763 22:15784689-15784711 CCCTTTGCCTAGGGAGCACCCGG - Intergenic
1181789681 22:25255286-25255308 CACTTGTCCAAGGTTGTACCAGG + Intergenic
1181824499 22:25504121-25504143 CACTTGCCCAAGGTTGCACCAGG + Intergenic
1184370684 22:44080116-44080138 CGCTTGTGCCAGGGGGCACCCGG + Intronic
1184852244 22:47127721-47127743 CACTTTTCCCAGGTAGCAGGAGG + Intronic
950113879 3:10438154-10438176 CAGTAATCCCAGGGTGCACATGG - Intronic
951679838 3:25283254-25283276 CACTTTTGCCAGCCTGAACCAGG + Intronic
952743624 3:36758041-36758063 CACTTTTCCCAGGGTGTATGGGG - Intergenic
953582292 3:44167910-44167932 GACCTTTCCTAGGGGGCACCTGG - Intergenic
960849025 3:122032698-122032720 GACTTTTCCCAGAGTGGACAAGG - Intergenic
961300457 3:125918689-125918711 CAGATGTCACAGGGTGCACCTGG - Intergenic
961888054 3:130109389-130109411 CAGATGTCGCAGGGTGCACCTGG + Intronic
962270483 3:133974626-133974648 CACATCTTCCAGGGAGCACCAGG - Intronic
962881252 3:139578909-139578931 CACTCTCCCAAGGGTCCACCCGG + Exonic
963770881 3:149384938-149384960 TACTTTTCCCAGGGAGGACCTGG - Intergenic
965240611 3:166192276-166192298 GACTTTTCCCAAGATGGACCAGG + Intergenic
968107071 3:196009021-196009043 CACCTCTCCCAGGGAGCCCCCGG + Intergenic
968508052 4:981156-981178 CACCTTTTCCAGGCTGCGCCGGG + Intronic
969080078 4:4611316-4611338 CACTTTTCCCTCCTTGCACCTGG - Intergenic
969377955 4:6775583-6775605 CACCTTTTCCAGGGTGCTTCCGG - Intergenic
969597845 4:8158916-8158938 TACACTTCCCAGGGTGCTCCCGG - Intergenic
969694069 4:8725087-8725109 CACTGTTCCCAGGGTGCGGCAGG - Intergenic
970804848 4:20018657-20018679 CACTTCTACCAGGGTTCACAAGG + Intergenic
972765373 4:42149153-42149175 CACTTCTGCGAGGGTGCAACAGG + Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
976216729 4:82721994-82722016 CACTGTCCCCAGTGTGCAACAGG - Intronic
980964919 4:139511937-139511959 CACTCTTCCCTGGGCACACCTGG + Intronic
982262387 4:153506168-153506190 TACTTTTCCCAGGTATCACCTGG - Intronic
986574832 5:9200897-9200919 CTCTTTTTCCTGGGTGAACCAGG - Intronic
994105061 5:95938315-95938337 CACTTTTCCCAGAATGAACAAGG - Intronic
994273161 5:97806243-97806265 CATTTTTCCCAGGGAGTCCCAGG + Intergenic
994770373 5:103973835-103973857 GACATTTCCCAGTGTCCACCTGG + Intergenic
996527258 5:124492228-124492250 CACTTTTCCCTTGATGCAGCTGG - Intergenic
997209157 5:132067503-132067525 CCCTTGACCCAGGGTGCTCCCGG + Intergenic
998573178 5:143283804-143283826 CATTTTTCACAGTGTGCTCCTGG + Intronic
1001120907 5:168979110-168979132 CAGTTTTCCCAGGATGAGCCTGG - Intronic
1001159022 5:169298183-169298205 CACTTTGGCCAGGGTGCATGGGG - Intronic
1002103639 5:176869394-176869416 CCCTTCTCCCAGGGGGCACTCGG - Intronic
1002302859 5:178267323-178267345 TTTTGTTCCCAGGGTGCACCAGG - Exonic
1002928750 6:1619681-1619703 CACTTTTCCCCGGCAGCGCCGGG - Intergenic
1007612435 6:43159116-43159138 CCTTTTTCCAAGGGTGCAGCAGG + Intronic
1007661502 6:43489596-43489618 CACTGCTGCCAGGCTGCACCAGG - Intronic
1009725265 6:67530114-67530136 CAGAGTTCCCAGGGTACACCTGG - Intergenic
1009923358 6:70090928-70090950 CAGCTTTCCCTGGATGCACCTGG + Intronic
1013447790 6:110248428-110248450 CACTTTTTCCTTGGTGGACCAGG - Intronic
1015559890 6:134503173-134503195 TATTCTTCCAAGGGTGCACCAGG - Intergenic
1015996447 6:138999592-138999614 CACTTTGCCCAGGCTGCATTTGG + Intergenic
1017402405 6:154079204-154079226 GACATTTCACAGGGTGCCCCAGG + Intronic
1019181865 6:170192425-170192447 CGCTCTTACCAAGGTGCACCCGG - Intergenic
1022636841 7:32144295-32144317 CATTTTCCCCAGGGTGCAACAGG + Intronic
1023176109 7:37437198-37437220 CATTTGTCCAAGGGTGCACAGGG - Intronic
1023640592 7:42253222-42253244 CACTGTGCCCCTGGTGCACCTGG + Intergenic
1023852209 7:44156835-44156857 CCCTTTCCTCAGGGTGCATCTGG + Intronic
1025032581 7:55570006-55570028 CAAATTTCCCAGGTTGCAGCCGG + Intronic
1026498570 7:70923755-70923777 CCCTCCTCCCAGGATGCACCAGG - Intergenic
1032279007 7:130486282-130486304 CCCTGTTCCCAGGGAGGACCCGG - Intronic
1032500985 7:132399564-132399586 CACTCTTCCCAGACTGCACTAGG - Intronic
1034232895 7:149546599-149546621 GACTCTTTCCAGGGGGCACCTGG - Intergenic
1034935124 7:155194170-155194192 CACTTTCTCCAGTGTGCATCTGG + Intergenic
1035172165 7:157022808-157022830 TCATTTTCCCAGGGTGGACCAGG - Intergenic
1035478141 7:159158309-159158331 TACTGTTCCCAGGCTGCATCTGG - Intergenic
1036050127 8:5187317-5187339 CGCTTTTCCGACGGCGCACCAGG + Intergenic
1036380047 8:8230668-8230690 CAGATGTCGCAGGGTGCACCTGG - Intergenic
1036849512 8:12191994-12192016 CAGATGTCGCAGGGTGCACCTGG + Intronic
1036870874 8:12434267-12434289 CAGATGTCGCAGGGTGCACCTGG + Intronic
1037317731 8:17614834-17614856 CAACTTTCCCAGGGTGCCTCAGG - Intronic
1038844238 8:31213971-31213993 CACTTTCCCAAGGGGCCACCTGG - Intergenic
1040909588 8:52504040-52504062 CAAGTTTCCCATGGTGCAGCTGG - Intergenic
1041220688 8:55648361-55648383 CTCTTGTCCCAGGAAGCACCTGG - Intergenic
1043811967 8:84752626-84752648 CAGTGTTCCCAGGCTGCACAGGG - Intronic
1048423723 8:134303289-134303311 CACTTTTGCCAGAGAGCACCTGG - Intergenic
1049040410 8:140108519-140108541 CCCCTTGCCCAGGGCGCACCTGG + Intronic
1049613898 8:143568072-143568094 CACTTGTTCCAGGGTTCACCGGG - Intronic
1049721768 8:144119726-144119748 CAGCTTTCCCAGGATTCACCAGG - Intergenic
1051231577 9:14960825-14960847 CACGTTTCCCAGGCTGAACTTGG + Intergenic
1055786465 9:79874251-79874273 CACTTTTCCCAATGTTCATCCGG - Intergenic
1059449173 9:114359610-114359632 GACTTTTCTCAGCCTGCACCGGG + Exonic
1061510393 9:131057451-131057473 CCCTTTTCCCAGGAAGGACCAGG + Intronic
1061853734 9:133430080-133430102 CACCTTCGCCAGGGAGCACCTGG + Exonic
1061980811 9:134102451-134102473 CACTTTTGACAGGGTGTACCCGG + Intergenic
1062373432 9:136251912-136251934 GGCTCTTCCCAGGGTGGACCAGG - Intergenic
1062373464 9:136251997-136252019 GGCTCTTCCCAGGGTGGACCAGG - Intergenic
1062373571 9:136252283-136252305 GGCTCTTCCCAGGGTGGACCAGG - Intergenic
1203526848 Un_GL000213v1:98272-98294 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1203526968 Un_GL000213v1:98911-98933 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1203527069 Un_GL000213v1:99541-99563 CACCTCTGCAAGGGTGCACCTGG - Intergenic
1186347554 X:8709848-8709870 TACCTTTCCCAGGGTGGACAAGG - Intronic
1187032305 X:15500617-15500639 CACTTTTCCCAGGCAGCTCTCGG - Intronic
1193046995 X:77064130-77064152 CACTCTCCCCACTGTGCACCTGG + Intergenic
1195952086 X:110285811-110285833 CTTTTTTCCCAGGGTGCTCTTGG - Intronic
1199720889 X:150542140-150542162 AACTTTTCCCAGGGTTCTGCTGG - Intergenic
1202019603 Y:20450854-20450876 CAGAATTCCCAGGGTGCACCTGG + Intergenic