ID: 911866117

View in Genome Browser
Species Human (GRCh38)
Location 1:103024301-103024323
Sequence ATTGATTTATTTGTAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5196
Summary {0: 1, 1: 2, 2: 65, 3: 555, 4: 4573}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911866113_911866117 29 Left 911866113 1:103024249-103024271 CCTGTGTAGCTGGGACTACAGGC 0: 856
1: 75143
2: 196314
3: 241135
4: 177804
Right 911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG 0: 1
1: 2
2: 65
3: 555
4: 4573
911866114_911866117 1 Left 911866114 1:103024277-103024299 CCAGCATGCCCAGCTTATTCATT 0: 1
1: 0
2: 40
3: 968
4: 19199
Right 911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG 0: 1
1: 2
2: 65
3: 555
4: 4573
911866115_911866117 -7 Left 911866115 1:103024285-103024307 CCCAGCTTATTCATTGATTGATT No data
Right 911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG 0: 1
1: 2
2: 65
3: 555
4: 4573
911866116_911866117 -8 Left 911866116 1:103024286-103024308 CCAGCTTATTCATTGATTGATTT No data
Right 911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG 0: 1
1: 2
2: 65
3: 555
4: 4573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911866117 Original CRISPR ATTGATTTATTTGTAAAGAC AGG Intronic
Too many off-targets to display for this crispr