ID: 911867156

View in Genome Browser
Species Human (GRCh38)
Location 1:103043320-103043342
Sequence ATGTGTGTCACATGTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911867153_911867156 11 Left 911867153 1:103043286-103043308 CCAAACAGTAAGTTTAAGGATTT 0: 1
1: 0
2: 0
3: 13
4: 211
Right 911867156 1:103043320-103043342 ATGTGTGTCACATGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911867156 Original CRISPR ATGTGTGTCACATGTCAGGA AGG Intronic
No off target data available for this crispr