ID: 911870020

View in Genome Browser
Species Human (GRCh38)
Location 1:103085456-103085478
Sequence TGCCCAGTGAAATCCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911870020 Original CRISPR TGCCCAGTGAAATCCCACGG AGG Intronic
902787925 1:18745181-18745203 TCCCCTGTCAAATCCCATGGTGG + Intronic
906908854 1:49925034-49925056 TGCCCAGTGAAACACCAGCGAGG + Intronic
907509166 1:54945710-54945732 AGCCCAGGGAGATCCCACAGAGG + Intergenic
911870020 1:103085456-103085478 TGCCCAGTGAAATCCCACGGAGG + Intronic
912723949 1:112042782-112042804 TGCCCAGTGGAATCCCGGGCAGG - Intergenic
916480911 1:165213559-165213581 TGCCCACTGAGATCCCAGAGGGG + Intronic
923144519 1:231188506-231188528 TTCCCATTAAAATCCCTCGGAGG - Intronic
1069955507 10:72048618-72048640 TGGCCAGGGAAATCCAACGGAGG - Intergenic
1073035768 10:100563173-100563195 TGCTCAGTGAAGCCCCATGGGGG + Intergenic
1076590411 10:131578469-131578491 TGGCCAGTGGACTCCCACGGAGG - Intergenic
1076739612 10:132476834-132476856 TCTCCAGTGAAATGCCACAGGGG - Intergenic
1084317559 11:68354220-68354242 AGCCCAGCCAAATTCCACGGAGG - Intronic
1084462074 11:69301833-69301855 TGCCCAGTGAGATTTCAGGGAGG - Intronic
1086571128 11:88285751-88285773 TGACCAGTAAAATCCCACCTGGG - Intergenic
1092915478 12:13185444-13185466 TTCTCAGTGAAGTCCCATGGTGG + Intergenic
1096829508 12:54303431-54303453 TGCCCAGTGAAATTCAAGGAAGG + Intronic
1100378104 12:94036243-94036265 TGTGCAGTGGAATCCCACTGTGG + Intergenic
1101464014 12:104928977-104928999 TGCCTCTTGAAATCCCACAGTGG + Intronic
1102569237 12:113817547-113817569 TGCCCAGTGCAAACCAGCGGAGG + Exonic
1103856172 12:123972675-123972697 TGCCCACTGACCTCCCTCGGCGG - Exonic
1107902289 13:45029233-45029255 TGCACAGGGAAATCCCCCTGAGG - Intronic
1110370511 13:74734912-74734934 TCCCCACTCAAATCTCACGGAGG + Intergenic
1120343251 14:83248830-83248852 AGCCCAGTGAAATCACAAGGAGG - Intergenic
1121435952 14:93919665-93919687 TCCCCAGGGAAGTCCCACGTGGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1127829061 15:62733962-62733984 AGCCCAGTGAACACCCATGGCGG - Intronic
1130872834 15:87984796-87984818 TGCACAGTGATAACCCACTGCGG + Intronic
1132640888 16:977761-977783 TGCCCAGGGAAATGCCACCCTGG - Intronic
1137498729 16:48993991-48994013 TGCCACGTGAAATGCCACAGTGG + Intergenic
1143122996 17:4621026-4621048 TGCCCATTGATTTCCCACTGTGG + Intergenic
1143983924 17:10894913-10894935 AGCCCAGTGGAATCCTATGGGGG + Intergenic
1146170809 17:30631444-30631466 TGCTCAGTCAAAGCCCAAGGTGG - Intergenic
1146257207 17:31398567-31398589 TACCCACTGATATCCCTCGGAGG - Intronic
1146344256 17:32047463-32047485 TGCTCAGTCAAAGCCCAAGGTGG - Intronic
1146521484 17:33528868-33528890 TGCCCAGGGAATTCACAAGGTGG - Intronic
1148114648 17:45168554-45168576 TGACCTGTGAAGTCCCACAGAGG - Intronic
1148170509 17:45515661-45515683 TGCTCAGTCAAAGCCCAAGGTGG + Intergenic
1148170986 17:45519654-45519676 TGCTCAGTCAAAGCCCAAGGTGG + Intergenic
1148278694 17:46330143-46330165 TGCTCAGTCAAAGCCCAAGGTGG - Intronic
1148300904 17:46548005-46548027 TGCTCAGTCAAAGCCCAAGGTGG - Intronic
1148365034 17:47048898-47048920 TGCTCAGTCAAAGCCCAAGGTGG - Intergenic
1149810100 17:59660537-59660559 TGCCCAGGGAAATTACTCGGAGG + Exonic
1150401599 17:64861258-64861280 TGCTCAGTCAAAGCCCAAGGTGG + Intronic
1150781711 17:68128565-68128587 TGCTCAGTCAAAGCCCAAGGTGG + Intergenic
1156652436 18:39240020-39240042 TCCCCTGTGAAATGACACGGAGG + Intergenic
1158287906 18:55905052-55905074 TGCCCATTGAAATTCCATGTCGG - Intergenic
1162227993 19:9240333-9240355 TGCCCAGTGTAATTTCATGGAGG + Intergenic
925801525 2:7606852-7606874 TGCACAAGGAAATCCCACTGAGG + Intergenic
926197557 2:10772966-10772988 TGCCCAGTGAACGGCCACAGCGG + Intronic
932620215 2:73260659-73260681 TGCCTTGTGAAATCCCACAGGGG - Intronic
938292324 2:130156768-130156790 TGCCCAGTGCTCTCCCCCGGCGG - Intronic
938464227 2:131516199-131516221 TGCCCAGTGCTCTCCCACGGTGG + Intergenic
939866691 2:147480978-147481000 TGCCTAGTGAAATCCCTTGTAGG - Intergenic
1169072602 20:2742589-2742611 TGCCCAGTGCCATCCCACTGTGG - Intronic
1172132864 20:32667343-32667365 TGCCCAGTGAGATGCCCAGGTGG + Intergenic
1173039364 20:39446615-39446637 TGGAGAGGGAAATCCCACGGTGG + Intergenic
1178035548 21:28578510-28578532 TCCCCAGTGAAACCCCGCTGTGG - Intergenic
1178121315 21:29473219-29473241 TGCCCAGTGACTTGCCACAGTGG + Intronic
1179394953 21:41030858-41030880 TGCTCAGTAGAATCCCATGGAGG - Intergenic
1179594554 21:42433724-42433746 TGCCCATGGAAATCCCAGGGAGG + Intronic
1181090363 22:20468361-20468383 TGTTCAGTGAAATCTCACAGAGG + Intronic
1184267406 22:43356462-43356484 TGCTCAGTGACATCCCAGGGTGG + Intergenic
1184598174 22:45526720-45526742 TGCCCTGTGAAAGCCCACACAGG - Intronic
950436873 3:12985438-12985460 TGCCCAGTGAAGGCCCAAGTTGG - Intronic
961039710 3:123669108-123669130 TGCCCAGTGAATGCCCCAGGAGG + Intronic
961146717 3:124599941-124599963 TTCCCAGTGAATTCCCAGTGAGG + Intronic
962090791 3:132242187-132242209 TGCCAAGTGAAAGACCAAGGGGG + Intronic
962681168 3:137801821-137801843 TGGCCAGTGAAAGTCCAGGGAGG - Intergenic
968421542 4:489148-489170 TGCCCAAGGGAAACCCACGGCGG - Intronic
969157544 4:5224514-5224536 TCTCCAGAGAAATCCCAAGGGGG - Intronic
969537808 4:7767438-7767460 TGCCCAATGACATCCCACTTAGG - Intronic
970950064 4:21744357-21744379 TGTCCAGTGGAATTCCAGGGAGG - Intronic
971602278 4:28608697-28608719 TGACCATTGAAATCCCAATGAGG + Intergenic
973792390 4:54390683-54390705 TGCCCATTGAAGTCCCTCAGTGG + Intergenic
974996233 4:69163099-69163121 TGCCCAGTGATATTCCTTGGAGG - Intronic
975009214 4:69328020-69328042 TGCCCAGTGATATTCCTTGGAGG - Intronic
977927056 4:102713243-102713265 TGCTCAGTGTAATCACACGGAGG - Intronic
980137528 4:128873073-128873095 TGGCCAGGGAAATCCCAAGCTGG - Exonic
982500232 4:156145093-156145115 TGTACAGTGTAATCCCATGGGGG + Intergenic
984608564 4:181812727-181812749 TGCTCAGTGAATGCCCAGGGTGG - Intergenic
985050598 4:185987447-185987469 TGCTCAGTGAAAGCCCTCTGTGG + Intergenic
987899313 5:23990356-23990378 ATCCCAGTGAAAACCCACAGTGG - Intronic
988126134 5:27040299-27040321 TTCCCACTGAAATCCAACTGTGG + Intronic
988516706 5:31911428-31911450 TGCCCAGTGAAGCCACATGGTGG - Intronic
997638221 5:135430694-135430716 TGCCCAGAGAAAACCCACGCAGG - Intergenic
1024944046 7:54791187-54791209 TGCCCAGTGCAATCTCCCTGTGG + Intergenic
1024962199 7:54989265-54989287 TGCGCAGTGAATACCCAGGGTGG + Intergenic
1034530780 7:151695125-151695147 TGCCCAGTGACATAACAGGGGGG + Intronic
1037777327 8:21844261-21844283 CCCCCAGTGAAATCCCATTGTGG - Intergenic
1038327073 8:26579369-26579391 TCCCCAGTGAAATCCCAGGGAGG + Intronic
1044096680 8:88074784-88074806 TGCGCCGTGAAATGCCAGGGAGG - Intronic
1045348170 8:101313599-101313621 TGCCCAGTGAACTGCCATGAAGG - Intergenic
1061567058 9:131447885-131447907 TGCCAAGGGAAAACACACGGTGG - Intronic
1200162960 X:154018703-154018725 TGCCCCGGGAAATCTCACAGAGG + Exonic