ID: 911870038

View in Genome Browser
Species Human (GRCh38)
Location 1:103085646-103085668
Sequence ATTCAGAGTAGACCATATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911870037_911870038 1 Left 911870037 1:103085622-103085644 CCTATATTCAAAAACAAGCAAAA 0: 1
1: 2
2: 6
3: 122
4: 1425
Right 911870038 1:103085646-103085668 ATTCAGAGTAGACCATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911870038 Original CRISPR ATTCAGAGTAGACCATATGC TGG Intronic
No off target data available for this crispr