ID: 911870941

View in Genome Browser
Species Human (GRCh38)
Location 1:103097645-103097667
Sequence CATTATATGCTAAAGGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911870941_911870943 6 Left 911870941 1:103097645-103097667 CCAACTACCTTTAGCATATAATG 0: 1
1: 0
2: 0
3: 10
4: 175
Right 911870943 1:103097674-103097696 TAACCTGTACTTGTCGAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911870941 Original CRISPR CATTATATGCTAAAGGTAGT TGG (reversed) Intronic
901916078 1:12501729-12501751 CAATATATGTTATAGGTTGTTGG - Intronic
905467008 1:38162648-38162670 CATAATATGCCAAAGGGAATAGG - Intergenic
908642034 1:66234936-66234958 CATTATATGTTAAAATTTGTAGG - Intronic
910389196 1:86720295-86720317 TATTTTATGTTAAAGGTACTTGG + Intronic
911870941 1:103097645-103097667 CATTATATGCTAAAGGTAGTTGG - Intronic
912475272 1:109930680-109930702 TATTATATGTTTAAGGTAGGGGG - Exonic
918997626 1:191782452-191782474 CATTATAGGCTAGAGGTTGCAGG + Intergenic
919087650 1:192939858-192939880 TATTATATGCTAGAGCTAGATGG - Intergenic
920010648 1:202865033-202865055 CAACACGTGCTAAAGGTAGTCGG + Intergenic
922379034 1:225002331-225002353 TATTTTATGATATAGGTAGTTGG + Intronic
1063242370 10:4184288-4184310 CATTATATGAAAAAGATACTTGG + Intergenic
1063272104 10:4521877-4521899 GAATATATTCTAAAGGTATTAGG + Intergenic
1066286817 10:33975514-33975536 CATTATCTGCTGACCGTAGTGGG - Intergenic
1067284175 10:44895329-44895351 CAGTATCTGCTAAAGGAAGTCGG - Intergenic
1068153027 10:53158506-53158528 CATAATATGGTAAAGGTGATGGG - Intergenic
1071101154 10:82039255-82039277 CATTATTTTCTAATGGAAGTTGG - Intronic
1072028285 10:91487983-91488005 CATTATATTATAAATATAGTAGG + Intronic
1073844229 10:107534781-107534803 AATTATATCATAAAGCTAGTTGG - Intergenic
1079874676 11:25842019-25842041 CATTATATGCCAAAGGCAATTGG - Intergenic
1080104851 11:28501210-28501232 TATTCAATTCTAAAGGTAGTAGG - Intergenic
1081071286 11:38612665-38612687 CATTATTTACCAAACGTAGTTGG + Intergenic
1081214766 11:40382610-40382632 CATTGCTTGCTATAGGTAGTAGG + Intronic
1081511172 11:43774896-43774918 CATTATATGGCAAAGGCAATGGG + Intronic
1086802147 11:91189810-91189832 CATTATATATCAAAGCTAGTAGG - Intergenic
1086840004 11:91673348-91673370 TATTTTATGCTAAAGGAATTTGG + Intergenic
1087077158 11:94135751-94135773 CACTATGTGCTGAAGGTAGGTGG + Intronic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1088357333 11:108957607-108957629 CATTGCATTCTAAAGGTACTGGG + Intergenic
1088478978 11:110274956-110274978 CATTATGTGGTAAAAGTAGAAGG - Intronic
1088832711 11:113551104-113551126 GATTTTGTTCTAAAGGTAGTGGG - Intergenic
1089875787 11:121720516-121720538 AATTTTATTCTAAATGTAGTAGG - Intergenic
1090026230 11:123169714-123169736 CAACATATGCTCAAGGTTGTAGG + Intronic
1094243239 12:28253824-28253846 CATTAAATGCCTAAGGTAGAAGG - Intronic
1094678140 12:32641993-32642015 CCTTACATACTAAAGATAGTGGG - Exonic
1097165735 12:57085700-57085722 ACTCAGATGCTAAAGGTAGTAGG - Intronic
1097623789 12:61974916-61974938 CAGTATATGACAAAGTTAGTGGG + Intronic
1097655337 12:62354539-62354561 TATTATATGCCAAAGGAAGAGGG + Intronic
1097965920 12:65581180-65581202 CATTATATGAAAAAGATACTTGG + Intergenic
1098153581 12:67573478-67573500 TATTTTATCCTAAAAGTAGTTGG - Intergenic
1098384984 12:69909103-69909125 CATGATATGTTAAAGGTGATTGG + Intronic
1100204956 12:92338963-92338985 TATTATGTGTTAAAGGTTGTAGG + Intergenic
1102262380 12:111451486-111451508 CATTATAGGCAGAAGGTATTTGG + Exonic
1105265630 13:18811534-18811556 CATGAAATGCTAAATCTAGTGGG + Intergenic
1106044929 13:26129996-26130018 CATTATATGCTAACTGTGGAAGG + Intergenic
1109134525 13:58630214-58630236 CATCATATGGGAAAAGTAGTGGG + Intergenic
1111342168 13:86900607-86900629 CATTATATGTAAAAGGTATTTGG + Intergenic
1112113255 13:96326054-96326076 AATTATAGTCTAAAGATAGTGGG + Intronic
1112169830 13:96959567-96959589 CATTACCTCATAAAGGTAGTGGG - Intergenic
1115849022 14:37573079-37573101 CATTTTAAGCTAAAGATTGTTGG + Intergenic
1118128940 14:62940499-62940521 CCTTTTATCCTAAAGGTTGTGGG - Intronic
1118243262 14:64082254-64082276 CGTTATATGATTAAGGTAATGGG + Intronic
1118597101 14:67444200-67444222 CAACATATGCTCAAGGTGGTCGG - Intergenic
1118799144 14:69173191-69173213 GCTTATATTCTAAAGGCAGTGGG + Intergenic
1120030667 14:79637227-79637249 CATAATATGCTAAAAGTTCTTGG + Intronic
1120450504 14:84660677-84660699 CATTATATGAAAAAGATACTTGG - Intergenic
1202832877 14_GL000009v2_random:56585-56607 CATGAAATGCTAAATCTAGTGGG - Intergenic
1125385975 15:39136898-39136920 AATTATATGAAAAAGGGAGTTGG - Intergenic
1130584424 15:85169379-85169401 CAATAGATGCTAAAGCTAGTGGG + Intergenic
1135183880 16:20298213-20298235 GATTTTATTCTAAGGGTAGTGGG + Intergenic
1137310697 16:47254365-47254387 AATAATATGCTAAAGAGAGTAGG - Intronic
1137888387 16:52131316-52131338 CATTGTGAGCTAAAGGCAGTGGG - Intergenic
1138949962 16:61900410-61900432 CCTTGTATGATAAAAGTAGTAGG - Intronic
1144069564 17:11656031-11656053 CATTATATGAAAAAGATACTGGG - Intronic
1144335699 17:14267302-14267324 CCTTATATGAGAAAGGTAGAGGG - Intergenic
1148824339 17:50381127-50381149 CATTAAATGCCAAAGGTAGGTGG - Exonic
1149475303 17:56956150-56956172 AAGTATATGATAAAAGTAGTAGG + Intronic
1154422769 18:14249994-14250016 CATGAAATGCTAAATCTAGTGGG - Intergenic
1155671166 18:28372812-28372834 AATTATGTGCTAAATGTGGTTGG - Intergenic
1155805501 18:30166065-30166087 CATTAAATGTTTAAGGAAGTTGG + Intergenic
1156908646 18:42384764-42384786 CAGTGGATGCTAAATGTAGTGGG - Intergenic
1157671128 18:49529620-49529642 CAACATATGCCCAAGGTAGTTGG - Intergenic
1162207628 19:9067618-9067640 CATTATATGGCAAAGCTGGTGGG - Intergenic
1164213929 19:23127025-23127047 CATTATATGCTTTAGGAACTCGG - Intronic
1164372855 19:27656901-27656923 CATTCTATGCTAAAGATACCTGG - Intergenic
1164713656 19:30376420-30376442 CATTATCTGGTATAAGTAGTGGG - Intronic
1202639804 1_KI270706v1_random:71139-71161 CATGAAATGCTAAATCTAGTGGG + Intergenic
928849742 2:35730799-35730821 CATTACAGGCTAAAAGAAGTAGG + Intergenic
933042427 2:77486614-77486636 CATTATATGCTAAATATAACTGG - Intronic
934495282 2:94790559-94790581 CATGAAATGCTAAATCTAGTGGG + Intergenic
934985159 2:98879937-98879959 CATTATGTGCTAAATGGTGTGGG - Intronic
935014577 2:99168466-99168488 GGTTGTATGCTAGAGGTAGTGGG - Intronic
936388434 2:112051885-112051907 AATTCTATTCTAAAGTTAGTTGG - Intergenic
939381108 2:141437584-141437606 CATATTATTCTTAAGGTAGTTGG - Intronic
941493113 2:166167087-166167109 CAGAAAATGCTAAAAGTAGTTGG + Intergenic
941568199 2:167135512-167135534 CATTATATGCTGAAGACAGAAGG - Intronic
943014717 2:182496993-182497015 CCTTATATGATAAATGGAGTTGG + Intronic
943579398 2:189667222-189667244 CCTTCTCTGTTAAAGGTAGTTGG - Exonic
946877490 2:224144317-224144339 TAAAATATTCTAAAGGTAGTGGG + Intergenic
1169338926 20:4781240-4781262 CATTATATGCTACCGATATTAGG + Exonic
1171886469 20:30655496-30655518 CATGAAATGCTAAATCTAGTGGG + Intergenic
1173698194 20:45041053-45041075 TATTATATGTTAAAGCTACTGGG + Intronic
1173754253 20:45501101-45501123 CAATGTATGCTAAAACTAGTGGG - Intergenic
1174048928 20:47753971-47753993 CATTACATGTTTAAAGTAGTTGG - Intronic
1174741151 20:53015451-53015473 AATTATTTGCTAGGGGTAGTTGG - Intronic
1174990646 20:55505595-55505617 CATTATATGGCAAAGGTGATGGG - Intergenic
1176648134 21:9368739-9368761 CATGAAATGCTAAATCTAGTGGG + Intergenic
1176850696 21:13909965-13909987 CATGAAATGCTAAATCTAGTGGG + Intergenic
1177823118 21:26053481-26053503 CGTAACATTCTAAAGGTAGTAGG - Intronic
1179343601 21:40535728-40535750 CATAACATGCTAAAGGTTGGTGG + Intronic
1181156247 22:20923129-20923151 CATTAAAAACTAAAGGAAGTTGG + Intronic
1184001790 22:41680093-41680115 CATTAGATGCTAAAGCTGATGGG - Intronic
952789479 3:37188161-37188183 AATTATATGGTAATGGTAATTGG + Intergenic
954141443 3:48608946-48608968 CATTATATGCTAAATAATGTTGG + Intronic
956455677 3:69418479-69418501 CATTATATGCCCAAGGTGATGGG + Intronic
958114296 3:89195489-89195511 CATTTTATGTTCAAGGTAATGGG - Intronic
961229755 3:125293851-125293873 CAATAGATGCTGAAGTTAGTGGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963670370 3:148244166-148244188 CATCATATACTAATGATAGTAGG + Intergenic
964226943 3:154414474-154414496 CAGTGCATGCTAAAGTTAGTTGG + Intronic
965232980 3:166077059-166077081 CATTATATGTAAAAGATACTTGG - Intergenic
966129758 3:176624077-176624099 CAATATTTGCTTAAGGAAGTTGG + Intergenic
1202738751 3_GL000221v1_random:36248-36270 CATGAAATGCTAAATCTAGTGGG - Intergenic
973370048 4:49237492-49237514 CATGAAATGCTAAATCTAGTGGG + Intergenic
973390977 4:49557918-49557940 CATGAAATGCTAAATCTAGTGGG - Intergenic
973835511 4:54805567-54805589 CGTTATATGAAAAAGGTACTTGG + Intergenic
974231654 4:59123537-59123559 CATTACATGCCAAATGTAATTGG + Intergenic
975910617 4:79262034-79262056 CATTATATTCAAAAGATATTAGG - Intronic
976324177 4:83752073-83752095 CATTATATGAGAAAGGAATTAGG - Intergenic
976936456 4:90641359-90641381 GATTATCTGTTAGAGGTAGTGGG + Intronic
979357410 4:119721287-119721309 CATTATATGAAAAAGATACTTGG + Intergenic
980668831 4:135975690-135975712 TATTTTATGCTAAAGTTCGTTGG + Intergenic
982332839 4:154200786-154200808 CAATAAATGCTAAAATTAGTGGG + Intergenic
982666270 4:158268450-158268472 CATTCTATTCTTAAGGTAGAGGG + Intergenic
983015923 4:162612109-162612131 CACTATATTCTAAACTTAGTAGG + Intergenic
984121781 4:175754251-175754273 CTTGATATGCTCAAGTTAGTTGG + Intronic
985240257 4:187923601-187923623 CATTATATGAAAAAGATACTTGG - Intergenic
1202767162 4_GL000008v2_random:156994-157016 CATGAAATGCTAAATCTAGTGGG + Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
992762629 5:79964262-79964284 CATGAAATGCTAAACGTAGTGGG + Intergenic
993499629 5:88650571-88650593 CATTATATGCTCAAGTTCATAGG - Intergenic
993685865 5:90936706-90936728 CACTATATGCTAAAATTTGTTGG - Intronic
997017081 5:129948653-129948675 CATTATATGGAAAAGATACTTGG - Intronic
998665601 5:144293778-144293800 CATTATATGCAAAATGTAACTGG - Intronic
1004638699 6:17493380-17493402 CATTATATCCTAAAACTTGTTGG - Intronic
1004893040 6:20120215-20120237 CATTTTATGCTCAAGGGAGCAGG - Intronic
1009864045 6:69374419-69374441 CATTATATGATAAAGCTTGCAGG - Intronic
1011099215 6:83703610-83703632 GACTATCTGGTAAAGGTAGTAGG - Intronic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1015407035 6:132849424-132849446 CAGTATATGTTAAAGGTTGAAGG - Intergenic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1021401132 7:20210554-20210576 CATTATTTCCTGAAGGCAGTGGG - Intronic
1022021943 7:26408391-26408413 AATTATATGCTGGAGGAAGTAGG + Intergenic
1023469725 7:40502836-40502858 AATTATATGTTAAATTTAGTTGG - Intronic
1030190812 7:106808489-106808511 CAACATATGCCCAAGGTAGTTGG + Intergenic
1033669858 7:143481509-143481531 CATCATATGGTAAAGGAAGTAGG - Intergenic
1037308520 8:17530394-17530416 ACTTATGTGCTAAGGGTAGTAGG + Intronic
1039148011 8:34471671-34471693 CTTTATATGCTAAATGTAGGAGG + Intergenic
1040101403 8:43510365-43510387 CATGAAATGCTAAATCTAGTGGG - Intergenic
1040739474 8:50555854-50555876 CATTTTATTGTAAAGCTAGTTGG + Intronic
1041977360 8:63815299-63815321 CAGTATATGCAAATGGAAGTGGG + Intergenic
1042633015 8:70841958-70841980 CAATGGATGCTAAAAGTAGTAGG - Intergenic
1043790481 8:84460988-84461010 CAGTGTTTGCTAAAGGTGGTAGG + Intronic
1043822529 8:84885846-84885868 TATTATATACAAAAGGTAGACGG - Intronic
1045945951 8:107796343-107796365 CCTTATATTCTAAAGGTCCTTGG + Intergenic
1046988539 8:120420348-120420370 CATTACATGCAAAAGCTAATGGG + Intronic
1051129596 9:13845023-13845045 CAATATATTCTAAAGTTAGGTGG - Intergenic
1051614003 9:18990210-18990232 CATTATAGGCTATAGGAAGTAGG - Intronic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1052876626 9:33572873-33572895 CATGAAATGCTAAATCTAGTGGG - Exonic
1053017231 9:34669158-34669180 CAACACATGCTAAAGGTGGTCGG - Intergenic
1053499374 9:38571472-38571494 CATGAAATGCTAAATCTAGTGGG + Intronic
1053661845 9:40289797-40289819 CATGAAATGCTAAATCTAGTGGG - Intronic
1053912302 9:42919971-42919993 CATGAAATGCTAAATCTAGTGGG - Intergenic
1054373973 9:64436033-64436055 CATGAAATGCTAAATCTAGTGGG - Intergenic
1054522764 9:66086487-66086509 CATGAAATGCTAAATCTAGTGGG + Intergenic
1054972477 9:71104873-71104895 TATTGTATGTTAAAGGGAGTAGG + Intronic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1059051253 9:110928771-110928793 CATTTTATGCTGAAGGGATTGGG - Intronic
1059685159 9:116628098-116628120 CAATATCTGCTAAAGGTGGGTGG - Intronic
1060838223 9:126774102-126774124 CAGTATATCCTAAAGTTATTTGG + Intergenic
1203691898 Un_GL000214v1:50058-50080 CATGAAATGCTAAATCTAGTGGG + Intergenic
1203707481 Un_KI270742v1:66692-66714 CATGAAATGCTAAATCTAGTGGG - Intergenic
1203547912 Un_KI270743v1:141871-141893 CATGAAATGCTAAATCTAGTGGG + Intergenic
1203644397 Un_KI270751v1:54133-54155 CATGAAATGCTAAATCTAGTGGG - Intergenic
1187417763 X:19107744-19107766 GATGATATGATATAGGTAGTTGG + Intronic
1187957950 X:24538845-24538867 GAAAATATGCTAAAGTTAGTGGG - Intronic
1189540111 X:41978372-41978394 CAATAGATGCTCAAGGTTGTTGG + Intergenic
1190295244 X:49022791-49022813 CATTAAATGCTAAAACTAGTGGG - Intergenic
1192047653 X:67693318-67693340 CAATATTTTCCAAAGGTAGTAGG + Intronic
1194791363 X:98154953-98154975 CATTATATGAAAAAGATACTTGG - Intergenic
1195779337 X:108443844-108443866 CAACATATGCTAAAATTAGTGGG - Intronic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197921544 X:131599547-131599569 CTTTTTATGCTTAAGGAAGTAGG + Intergenic
1199055278 X:143286731-143286753 CATTATAAGCTGAAGGTTTTGGG + Intergenic
1199765610 X:150939673-150939695 CAATAGATGCTAAAACTAGTGGG - Intergenic
1201260445 Y:12153897-12153919 AATTTTATGCTCAAAGTAGTTGG - Intergenic