ID: 911880407

View in Genome Browser
Species Human (GRCh38)
Location 1:103231381-103231403
Sequence TATCCAAAACTGATGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911880407_911880409 -1 Left 911880407 1:103231381-103231403 CCTATCTTCATCAGTTTTGGATA No data
Right 911880409 1:103231403-103231425 ATCCATGCTGATTTTGTGTAGGG No data
911880407_911880408 -2 Left 911880407 1:103231381-103231403 CCTATCTTCATCAGTTTTGGATA No data
Right 911880408 1:103231402-103231424 TATCCATGCTGATTTTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911880407 Original CRISPR TATCCAAAACTGATGAAGAT AGG (reversed) Intergenic
No off target data available for this crispr