ID: 911882543

View in Genome Browser
Species Human (GRCh38)
Location 1:103259622-103259644
Sequence ATGTGTATGAATAAGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911882538_911882543 14 Left 911882538 1:103259585-103259607 CCAATTGTGTGTGTCTGTGTTAT No data
Right 911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG No data
911882536_911882543 22 Left 911882536 1:103259577-103259599 CCTAATTCCCAATTGTGTGTGTC No data
Right 911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG No data
911882537_911882543 15 Left 911882537 1:103259584-103259606 CCCAATTGTGTGTGTCTGTGTTA No data
Right 911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911882543 Original CRISPR ATGTGTATGAATAAGTAGGA GGG Intergenic
No off target data available for this crispr