ID: 911883569

View in Genome Browser
Species Human (GRCh38)
Location 1:103270447-103270469
Sequence AGTTATAGGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911883569_911883574 4 Left 911883569 1:103270447-103270469 CCTGCCATCTTCTGCCTATAACT No data
Right 911883574 1:103270474-103270496 CCCTTTTGAGAGACAGCTCTTGG No data
911883569_911883576 22 Left 911883569 1:103270447-103270469 CCTGCCATCTTCTGCCTATAACT No data
Right 911883576 1:103270492-103270514 CTTGGCCTTCTACTCAGCTTTGG No data
911883569_911883577 25 Left 911883569 1:103270447-103270469 CCTGCCATCTTCTGCCTATAACT No data
Right 911883577 1:103270495-103270517 GGCCTTCTACTCAGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911883569 Original CRISPR AGTTATAGGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr