ID: 911883779

View in Genome Browser
Species Human (GRCh38)
Location 1:103271981-103272003
Sequence TAGTTGATCACTAGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911883779_911883783 21 Left 911883779 1:103271981-103272003 CCATCATCCCTAGTGATCAACTA No data
Right 911883783 1:103272025-103272047 CCCGCGACATTACATTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911883779 Original CRISPR TAGTTGATCACTAGGGATGA TGG (reversed) Intergenic
No off target data available for this crispr