ID: 911885977

View in Genome Browser
Species Human (GRCh38)
Location 1:103300099-103300121
Sequence CATTTTCCTGCTCTTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911885977_911885978 -6 Left 911885977 1:103300099-103300121 CCAGAATCAAGAGCAGGAAAATG No data
Right 911885978 1:103300116-103300138 AAAATGAATGCTTGAGTAACTGG No data
911885977_911885979 12 Left 911885977 1:103300099-103300121 CCAGAATCAAGAGCAGGAAAATG No data
Right 911885979 1:103300134-103300156 ACTGGCATCATCAGTACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911885977 Original CRISPR CATTTTCCTGCTCTTGATTC TGG (reversed) Intergenic
No off target data available for this crispr