ID: 911889123

View in Genome Browser
Species Human (GRCh38)
Location 1:103344722-103344744
Sequence GGGACTGATCCCTTAATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911889123_911889131 19 Left 911889123 1:103344722-103344744 CCACATATTAAGGGATCAGTCCC No data
Right 911889131 1:103344764-103344786 CAGATGTAATAGCAAGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911889123 Original CRISPR GGGACTGATCCCTTAATATG TGG (reversed) Intergenic
No off target data available for this crispr