ID: 911900560

View in Genome Browser
Species Human (GRCh38)
Location 1:103497951-103497973
Sequence GGTACATGGTTGAGACCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911900560_911900565 -8 Left 911900560 1:103497951-103497973 CCTAAAGGTCTCAACCATGTACC No data
Right 911900565 1:103497966-103497988 CATGTACCTGGCAATGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911900560 Original CRISPR GGTACATGGTTGAGACCTTT AGG (reversed) Intergenic
No off target data available for this crispr