ID: 911905640

View in Genome Browser
Species Human (GRCh38)
Location 1:103565154-103565176
Sequence TCATCTCTCCAGTATCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911905631_911905640 23 Left 911905631 1:103565108-103565130 CCCCAGCAGGTGCCTGAAACCAC 0: 1
1: 10
2: 41
3: 201
4: 667
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905629_911905640 30 Left 911905629 1:103565101-103565123 CCAAGACCCCCAGCAGGTGCCTG 0: 1
1: 17
2: 70
3: 375
4: 1111
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905632_911905640 22 Left 911905632 1:103565109-103565131 CCCAGCAGGTGCCTGAAACCACA 0: 1
1: 9
2: 34
3: 184
4: 602
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905636_911905640 -8 Left 911905636 1:103565139-103565161 CCAAGCCTTTTGCAGTCATCTCT 0: 1
1: 0
2: 0
3: 23
4: 286
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905634_911905640 11 Left 911905634 1:103565120-103565142 CCTGAAACCACAGATAGTACCAA 0: 39
1: 169
2: 288
3: 527
4: 791
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905633_911905640 21 Left 911905633 1:103565110-103565132 CCAGCAGGTGCCTGAAACCACAG 0: 1
1: 5
2: 43
3: 188
4: 616
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905630_911905640 24 Left 911905630 1:103565107-103565129 CCCCCAGCAGGTGCCTGAAACCA 0: 1
1: 7
2: 50
3: 260
4: 650
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
911905635_911905640 4 Left 911905635 1:103565127-103565149 CCACAGATAGTACCAAGCCTTTT 0: 1
1: 0
2: 11
3: 94
4: 361
Right 911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911905640 Original CRISPR TCATCTCTCCAGTATCTGTG GGG Intronic
900892727 1:5461218-5461240 TCATCCATCCAGTATTTATGAGG - Intergenic
902143081 1:14373158-14373180 TCATTGCTCCAGTATTTGTTAGG + Intergenic
902584332 1:17428954-17428976 TCATCACTACAGTGGCTGTGTGG + Intronic
903460034 1:23514383-23514405 TGATCTCTCCTGTGTCTGTCAGG - Intronic
906544525 1:46611947-46611969 TCATCTCTGCAGAGGCTGTGTGG - Intronic
907812947 1:57890233-57890255 CCATCTCTCCAGTCTTTGAGGGG + Intronic
907950701 1:59180670-59180692 GCATCTGTCCAGTATTTGTGTGG + Intergenic
909777211 1:79496600-79496622 TCAAGTCTGTAGTATCTGTGGGG - Intergenic
911226553 1:95312799-95312821 TCATCTCTGCAGCATTTATGAGG - Intergenic
911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG + Intronic
911926899 1:103844139-103844161 ACATATCTCTAGTTTCTGTGTGG - Intergenic
914229611 1:145753632-145753654 GCATCACTCCAGTATCTCTTTGG - Intronic
914658947 1:149769777-149769799 TCATCTCCCCTTTCTCTGTGAGG - Intergenic
917036667 1:170755107-170755129 CCATCTCTCAAGTTTCTTTGAGG + Intergenic
917679508 1:177351444-177351466 TCCTCATTCCAGTGTCTGTGGGG - Intergenic
922149910 1:222991376-222991398 TCACCTCTGGAGTAGCTGTGAGG + Intronic
922772603 1:228195157-228195179 TCATTTCTGGTGTATCTGTGAGG + Intergenic
923965320 1:239131749-239131771 TCTTCTCTCCAATATTTTTGTGG - Intergenic
924089795 1:240490756-240490778 TAATCCCTCCCCTATCTGTGTGG + Exonic
1063478687 10:6351212-6351234 TCAGCTCTTCCGTAACTGTGAGG - Intergenic
1064825011 10:19388563-19388585 TCATCTCCACAATCTCTGTGAGG - Intronic
1064928259 10:20594039-20594061 TCCACTCTCCTGTATCTGTGTGG + Intergenic
1066052199 10:31646025-31646047 TCATCCCGCCAGTACCTTTGTGG - Intergenic
1068006783 10:51400414-51400436 CCATCTCTCCATTATCTGTGTGG - Intronic
1068753656 10:60625282-60625304 TCATCTCTCATGGCTCTGTGGGG - Intronic
1071146483 10:82579936-82579958 TGGTATCTGCAGTATCTGTGAGG + Intronic
1071814321 10:89216777-89216799 TCATCCCTCAAGTATCTTTGGGG - Intronic
1072572430 10:96670464-96670486 TGGTCTCTCCAGTACCAGTGAGG - Intronic
1075767222 10:124903219-124903241 TCCTCTCTCCAGTCTCTGCCAGG - Intergenic
1076413448 10:130267887-130267909 TCAGCTCTCCAGTTTCAGGGTGG - Intergenic
1076709761 10:132326099-132326121 TCATCTCTTCAGGATCGGGGAGG + Intronic
1077788278 11:5409206-5409228 TCCACTCTCCAGAATCTGAGAGG - Intronic
1078553071 11:12293737-12293759 TCATCTCTGCAGGGTCTGAGAGG - Exonic
1079432442 11:20406065-20406087 TCGTTCCTTCAGTATCTGTGAGG + Intronic
1084322742 11:68382632-68382654 TCATCCCACCAGTATCTCTGTGG - Intronic
1085936369 11:81150748-81150770 TCATCACCACAGTTTCTGTGAGG + Intergenic
1086512992 11:87580251-87580273 TCTTCTCTCCAGGATCTGGATGG + Intergenic
1089855802 11:121543620-121543642 TCTTCTCCCCAGGTTCTGTGAGG - Exonic
1089994209 11:122889624-122889646 TCATCGCTCAGTTATCTGTGAGG - Intronic
1090523337 11:127502716-127502738 TTGCCTCTCCACTATCTGTGTGG + Intergenic
1091109399 11:132951688-132951710 TCTTCTCTGAAGTATCTCTGTGG + Intronic
1091672229 12:2460383-2460405 TCATCTCCTCAGTCTCTTTGTGG - Intronic
1092923969 12:13257357-13257379 TCAATTCTCAATTATCTGTGAGG + Intergenic
1093405340 12:18797856-18797878 ACAGATTTCCAGTATCTGTGAGG + Intergenic
1093425757 12:19027303-19027325 TCATCACTGCAGCAGCTGTGTGG - Intergenic
1093558216 12:20504599-20504621 TCCTTTCTCAAGTATCTGAGAGG + Intronic
1095117585 12:38373587-38373609 TGATCCCTCCAGTTCCTGTGTGG - Intergenic
1096111063 12:49029462-49029484 TCACCTCTGAAGTATCTGAGGGG + Exonic
1096501890 12:52069376-52069398 CCCTTTCTCCAGCATCTGTGTGG + Intronic
1097426086 12:59446330-59446352 TCATCTCTCTTGGAGCTGTGAGG + Intergenic
1101850760 12:108400222-108400244 TCATCTCTGCATTATTTATGAGG - Intergenic
1101938615 12:109081970-109081992 TCATCTCATCAGAATCAGTGCGG + Exonic
1103922175 12:124404728-124404750 TCAGCTCTCGGGGATCTGTGGGG - Intronic
1104038696 12:125115653-125115675 TCCTCCCTCCTGCATCTGTGGGG - Intronic
1107327626 13:39262045-39262067 TCTTCTCTCCAGAATCAGAGAGG - Intergenic
1113824469 13:113240397-113240419 TCAGTTCTCCTGTTTCTGTGAGG - Intronic
1116011046 14:39352544-39352566 TCACCTCTTTGGTATCTGTGGGG + Intronic
1116966022 14:51016016-51016038 TTGTCTCCTCAGTATCTGTGGGG + Intronic
1117012770 14:51487818-51487840 TCATTTCTACAGTATCAGTGGGG - Intergenic
1117927298 14:60795648-60795670 TGAGCGCTCCAGTATGTGTGAGG - Intronic
1119623332 14:76149951-76149973 TCATCTCTGCAGCATTTCTGAGG - Intergenic
1124594621 15:31082491-31082513 TTATCTGTACAGTATCTGGGAGG + Intronic
1125967724 15:43887694-43887716 TCATCTCTCCAGGATCCTTCAGG + Intronic
1126469300 15:48990706-48990728 TCTTCTCTCCTGCCTCTGTGAGG + Exonic
1129984303 15:79903699-79903721 TCAAATCTCCAGTTTCAGTGTGG + Intronic
1130415509 15:83690945-83690967 TCCTCTCACCAGTAGCAGTGGGG + Intronic
1130957765 15:88639331-88639353 CCCTCTCTCCAGCATCTCTGAGG + Exonic
1133528334 16:6628189-6628211 TCATCTCACCAGTCTCCCTGGGG + Intronic
1145374879 17:22338085-22338107 ACGTCTCTCCAGCTTCTGTGAGG + Intergenic
1146129442 17:30258696-30258718 ACAGCTCTCCAGGATCTCTGAGG + Intronic
1146439122 17:32877832-32877854 TCATCTCTCCAGGATTATTGCGG + Intergenic
1147474437 17:40696726-40696748 TCATTTCTACAGTATCCCTGAGG - Intergenic
1149244778 17:54692792-54692814 TCATCTCTTATGCATCTGTGAGG + Intergenic
1149397012 17:56255238-56255260 TCTTCCCTCCAGTATATTTGAGG - Intronic
1150525192 17:65915464-65915486 AGATCTCTCCAGTTGCTGTGTGG - Intronic
1150715658 17:67570566-67570588 ACATCTCTCCAGCATCTGCCAGG + Intronic
1151467957 17:74299865-74299887 TCCTCTCTCCAGTGTCTGGCTGG - Intronic
1151781823 17:76251794-76251816 TCATCTCACCAGCCTCTGTGGGG + Intergenic
1159094098 18:63882622-63882644 TCACCTCTCCATTATCCTTGTGG - Intronic
1159563000 18:70015558-70015580 TCAGCTGTGCAGTTTCTGTGTGG - Intronic
1162179688 19:8859646-8859668 TCACCTCTCCAGTATCAAAGTGG + Intronic
1162858541 19:13488330-13488352 AAATCTCTCCAGCATCTGTGGGG + Intronic
1167225178 19:48233882-48233904 TTATGTCTCTTGTATCTGTGTGG + Intronic
1168174601 19:54616087-54616109 TCTACTCTCCAGTATCTTTAAGG + Intronic
927449178 2:23191791-23191813 GCATCTTTCCAGTATCTGTTTGG + Intergenic
927717109 2:25360047-25360069 CCATATCTCCAGGGTCTGTGTGG - Intergenic
927740872 2:25568716-25568738 TCTTCTACCCAGTATCTGTTTGG - Intronic
928679817 2:33690201-33690223 GCATCTGTCCAGCATCTATGAGG - Intergenic
929947310 2:46381022-46381044 TCATCACTCAATTTTCTGTGTGG - Intronic
933426316 2:82116507-82116529 TGATCTCTTCAATATCTGTCAGG + Intergenic
933489330 2:82965577-82965599 TCATGTCTTCTGTATCTGCGAGG - Intergenic
936035780 2:109110025-109110047 TCAGATCTCCAGGATCTGAGAGG - Intergenic
936720479 2:115246531-115246553 ACATTTCTCCTGTCTCTGTGAGG - Intronic
940546062 2:155087005-155087027 CCATCTCTCCTTTATATGTGTGG + Intergenic
945779983 2:214157080-214157102 TCCTTTCTCCAGAATCAGTGAGG - Intronic
946031244 2:216706884-216706906 TCTTCTATCTAGTAGCTGTGTGG - Intergenic
946595912 2:221305805-221305827 TAATCTCTCCAGAATCTTTGGGG - Intergenic
948856042 2:240731112-240731134 AAATCTCTCCTGTCTCTGTGTGG - Intronic
1169133506 20:3181198-3181220 GCATCTCTTCAGTATCAGCGAGG - Intergenic
1169732450 20:8801219-8801241 TCATCTCCCAAGTGTCTGTTTGG + Intronic
1170459575 20:16564748-16564770 TCATCTCTCCATTAACTGGAAGG + Intronic
1171334644 20:24372155-24372177 TCATCTTTCCATTTTCTCTGTGG - Intergenic
1171527921 20:25830326-25830348 CCGTCTCTCCAGCTTCTGTGAGG - Intronic
1171548905 20:26025554-26025576 CCGTCTCTCCAGCTTCTGTGAGG + Intergenic
1175153746 20:56955253-56955275 ACCTCTCTCCAGTATTTTTGAGG - Intergenic
1175497722 20:59426254-59426276 TCATCTCTGTAGTTACTGTGAGG + Intergenic
1177774524 21:25553357-25553379 GCATCTCACCAGTCTCTGTAGGG - Intergenic
1182219953 22:28750475-28750497 TCATCTCTCAGGTAGCAGTGTGG - Intronic
1182488277 22:30652828-30652850 TCATTTCTCCAGTATCTTATTGG + Intronic
1182591223 22:31381847-31381869 CAACCTCACCAGTATCTGTGGGG + Intergenic
1182747817 22:32619021-32619043 TCCTCTCTATAGAATCTGTGAGG + Intronic
1183061326 22:35338052-35338074 TCATCTGCCCAGCAACTGTGGGG + Intronic
1184633647 22:45807328-45807350 TCACCTTTCCAGTGTGTGTGTGG + Intronic
949166940 3:954332-954354 TGGTCTCTTCAGTTTCTGTGTGG - Intergenic
949398860 3:3644793-3644815 TTATCTCTCAAGTTTCTCTGTGG - Intergenic
951220495 3:20064015-20064037 TCATTTGACCATTATCTGTGAGG + Intronic
954565278 3:51594774-51594796 TCATCTCTCCAGTCTCACTCTGG - Intronic
955796645 3:62644371-62644393 TGATCTCTCAAGAATCTTTGAGG + Intronic
957157537 3:76564608-76564630 TAATCTTTCCAGGCTCTGTGAGG + Intronic
958878639 3:99644153-99644175 TCATCTCTCAAGCATTTGAGAGG - Intronic
959325076 3:104926919-104926941 TCATTTCTCCAGCTTCTGGGAGG + Intergenic
960088103 3:113612001-113612023 TCCTCTCTCCTGTATGTGTAAGG - Intronic
960699065 3:120423483-120423505 TCATCTCACAAAGATCTGTGAGG + Intronic
961040991 3:123678228-123678250 TCTTCACTCCAGCATCTGTGTGG + Intronic
961661917 3:128473494-128473516 TCGTCTCTCCAGTATCACTAGGG - Intergenic
965142686 3:164860200-164860222 TGACCTCTCAAGTATCTTTGAGG + Intergenic
966056549 3:175699548-175699570 TCACCTCTCAAGTAACTGAGGGG - Intronic
966898737 3:184465236-184465258 TCCTGTTTCCAGGATCTGTGAGG + Intronic
968159461 3:196413741-196413763 TCATCCCTCCAGTATCCATGGGG + Intronic
968451004 4:675992-676014 TCTTTTCTCCAGCTTCTGTGAGG + Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
971770779 4:30894001-30894023 TCAGTTCTCCAGTATCTGTCTGG - Intronic
972731481 4:41799299-41799321 TTATGTCTCCAGTAACTCTGAGG - Intergenic
973345434 4:49049715-49049737 CCATTCCTCCAGTATCTGTATGG + Intronic
975319914 4:72998109-72998131 TCATCCCCACAGTATCTATGGGG + Intergenic
978286117 4:107079195-107079217 GGATCTCTCTGGTATCTGTGTGG - Intronic
979642931 4:123031057-123031079 TCATCTATTCAGTGTTTGTGAGG + Intronic
981338771 4:143596246-143596268 ACATCTGTCCAGTGTCAGTGTGG + Intronic
981943356 4:150311272-150311294 TCATCTCTCCAGTACAAGTAAGG + Intronic
982129570 4:152215865-152215887 GCATCACTCCACTGTCTGTGAGG - Intergenic
983182373 4:164663389-164663411 ACATCTCTTCTGAATCTGTGGGG + Intergenic
983929723 4:173440214-173440236 TGCTCTCTACAGAATCTGTGTGG + Intergenic
984647621 4:182236346-182236368 TCATCACTCCTGCATCAGTGTGG + Intronic
984860151 4:184230546-184230568 TAGTCCCTCCAGTATCTGGGCGG - Intergenic
985880167 5:2633367-2633389 TTGTCTCTCCAGCTTCTGTGAGG - Intergenic
986073313 5:4309087-4309109 TCATCTCTCCCTTGTCTCTGGGG - Intergenic
986468578 5:8051235-8051257 TCATCTCTCCATAAACTGTGGGG - Intergenic
990588836 5:57241239-57241261 TCAACTCTGAATTATCTGTGTGG + Intronic
990986110 5:61642321-61642343 TCATCCCTACTGTAGCTGTGAGG - Intronic
993897875 5:93559849-93559871 TCATTACTACAGTATCTGTTAGG - Intergenic
996603439 5:125293090-125293112 TCCTCTGTCTAGTGTCTGTGAGG - Intergenic
998493661 5:142568340-142568362 TCATCTCTCCTGTCTGGGTGGGG - Intergenic
1001413730 5:171528706-171528728 CCATTTATCCAGCATCTGTGAGG - Intergenic
1001699860 5:173699043-173699065 TCATCACTCCAGTCTCAGTATGG - Intergenic
1004335724 6:14762706-14762728 TCTTCTGTCCTGTGTCTGTGGGG - Intergenic
1008668909 6:53746515-53746537 TCATCCCTCCTGAGTCTGTGAGG - Intergenic
1012405424 6:98891529-98891551 TGATCAGTCGAGTATCTGTGAGG - Intronic
1013744039 6:113323326-113323348 ACATTTCTACATTATCTGTGAGG + Intergenic
1014756465 6:125306765-125306787 TCATCTTTCCAGTCTCTGTCAGG - Intergenic
1015663750 6:135603946-135603968 TCATCTCTCCTTCATCTCTGTGG - Intergenic
1015962987 6:138669725-138669747 TCAGCTTTCCAGGAGCTGTGTGG - Intronic
1016381607 6:143489204-143489226 TCATTTCTCCAGTTGCTGAGGGG - Exonic
1016890206 6:148998624-148998646 TGATCTCTCCATTTTCTGTGTGG + Intronic
1017702151 6:157084802-157084824 TCATCTCTCCAGCATCCCGGGGG + Exonic
1018345932 6:162899392-162899414 TCACCTTTCTAGGATCTGTGTGG + Intronic
1018738902 6:166712500-166712522 TTATCTAACAAGTATCTGTGAGG + Intronic
1021508685 7:21411940-21411962 TCATCTCTCCAGCTTCCCTGTGG + Intergenic
1022231323 7:28415754-28415776 TCTTTTCTCTATTATCTGTGAGG + Intronic
1022922946 7:35034985-35035007 TCCTCTCTGCAGGATCTGAGTGG + Intronic
1023552800 7:41387868-41387890 TCATTTCTCCTGATTCTGTGGGG + Intergenic
1024216949 7:47255960-47255982 TCTTCTCTCTGGGATCTGTGAGG + Intergenic
1025297722 7:57789557-57789579 CCGTCTCTCCAGCTTCTGTGAGG + Intergenic
1028039521 7:86032185-86032207 TCATCTCTCTAGTATCCTTCTGG - Intergenic
1028201840 7:87971594-87971616 ACGTTTTTCCAGTATCTGTGAGG + Intronic
1028549616 7:92045506-92045528 TACTCTTACCAGTATCTGTGAGG + Intronic
1033949862 7:146771749-146771771 TCATTTCTCCAGTATCATTGGGG + Intronic
1035062849 7:156082020-156082042 TGCTCTCTCCAGTCTCTGTCAGG - Intergenic
1037065384 8:14570302-14570324 TCATTTCTCCTGAATCTTTGAGG + Intronic
1037448890 8:18997044-18997066 TCATCTCTTCAATCTCAGTGTGG + Intronic
1039490893 8:37946785-37946807 CCATCTCTCTAGGATCTGCGGGG - Intergenic
1039861489 8:41462845-41462867 TCATCTCTCTAGGATGTGTCTGG - Intergenic
1040565795 8:48565577-48565599 GCATCCCTCCTGCATCTGTGCGG - Intergenic
1041876445 8:62692841-62692863 ACAGCTCTCCAGAATCTGGGAGG - Intronic
1043217526 8:77612165-77612187 TTTTCTCTCCAGTATTTGTATGG - Intergenic
1044264050 8:90161914-90161936 TCATCATGTCAGTATCTGTGTGG + Intergenic
1045568504 8:103345841-103345863 TCATCTCTCCATAAAATGTGTGG + Intergenic
1047117305 8:121858079-121858101 ACATCTCTCGAGTCTCTGTCTGG + Intergenic
1047961494 8:130015241-130015263 TCATCTCACAATTATCTATGGGG + Intronic
1049134730 8:140885907-140885929 TCATCTCTCCAGGATCATTCTGG + Intronic
1050745402 9:8870355-8870377 TCTTCTCTCCAGTCTCTGTGTGG - Intronic
1052703830 9:31970199-31970221 TCTTCTCCCAAGTCTCTGTGAGG + Intergenic
1053795885 9:41726474-41726496 CCATCTCTCCAGCTTCTGTGAGG - Intergenic
1054149294 9:61588399-61588421 CCATCTCTCCAGCTTCTGTGAGG + Intergenic
1054184292 9:61938545-61938567 CCATCTCTCCAGCTTCTGTGAGG - Intergenic
1054469056 9:65519510-65519532 CCATCTCTCCAGCTTCTGTGAGG + Intergenic
1054654214 9:67649950-67649972 CCATCTCTCCAGCTTCTGTGAGG + Intergenic
1055609934 9:78011760-78011782 GTATCTCTCCATTATTTGTGTGG - Intronic
1059683011 9:116604686-116604708 TCTTTTCTCCAGTAGCTGAGAGG - Intronic
1059719330 9:116944357-116944379 TCTTCTCTCCCATGTCTGTGTGG - Intronic
1060275810 9:122181600-122181622 TCAGCTCCCCAGCCTCTGTGGGG - Intronic
1061209884 9:129184982-129185004 TCATTTCTCAAGTGTGTGTGAGG + Intergenic
1186200938 X:7154040-7154062 CCCTCTCTCCAGGACCTGTGAGG + Intergenic
1186668942 X:11749423-11749445 TCACCTCTCCTGCATCAGTGCGG - Intergenic
1186918247 X:14246915-14246937 TCTTCTCTCTAGTATCTTAGAGG + Intergenic
1192421761 X:71038638-71038660 ATAACTCTCCAGTATCAGTGAGG + Intergenic
1198969701 X:142267432-142267454 TGCTATCTCCAGTAACTGTGAGG - Intergenic
1199059914 X:143343004-143343026 TCATCTGACCATTGTCTGTGAGG + Intergenic
1201641860 Y:16188081-16188103 TGCTGTCTCCAGTTTCTGTGTGG + Intergenic
1201660955 Y:16397240-16397262 TGCTGTCTCCAGTTTCTGTGTGG - Intergenic