ID: 911906548

View in Genome Browser
Species Human (GRCh38)
Location 1:103576249-103576271
Sequence CTGTGTGACTCAGAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 3, 2: 4, 3: 41, 4: 532}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911906548 Original CRISPR CTGTGTGACTCAGAGGAAGG AGG (reversed) Intronic
900636715 1:3669561-3669583 CTGTGTGAGGCTGAGGATGGCGG - Intronic
900870949 1:5302342-5302364 CTGTGTGGCACAGTGGAAGGAGG - Intergenic
901525542 1:9820274-9820296 CTGTGGGAGGCAGAGGCAGGCGG + Intronic
901976155 1:12945742-12945764 CTCTGGGACGCAGAGGTAGGTGG + Intronic
901998344 1:13172116-13172138 CTGTGGGAGGCAGAGGCAGGTGG - Intergenic
902009017 1:13256023-13256045 CTCTGGGACGCAGAGGTAGGTGG - Intronic
902249703 1:15146248-15146270 CCGTGTGCCCCAGAGGAGGGAGG - Intergenic
902366019 1:15975064-15975086 CTCCGTGCTTCAGAGGAAGGAGG + Intronic
903121460 1:21219214-21219236 CTGTTGGACTCAGGGGACGGAGG + Intronic
903244754 1:22007305-22007327 CTAGGTGCCCCAGAGGAAGGGGG - Intronic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903375525 1:22863400-22863422 CCATGTGACTCAGCAGAAGGGGG - Intronic
903562171 1:24236344-24236366 GTGGGTGACTCAGAGACAGGCGG - Intergenic
904731034 1:32591460-32591482 CTTTGGGAGTCAGAGGCAGGAGG - Intronic
906031596 1:42725003-42725025 CTTTGGGAGTCAGAGGCAGGAGG + Intergenic
906040137 1:42782587-42782609 CTTTGGGACTCTGAGGCAGGAGG + Intronic
906101605 1:43267468-43267490 CTCTGTTCCTCTGAGGAAGGCGG + Intronic
906612072 1:47210425-47210447 CTGTCTGACTCTGTGGAAGCAGG + Intergenic
907725601 1:57017486-57017508 CTGTATCAGTCAGATGAAGGCGG - Intronic
907830000 1:58055979-58056001 CTGTGTGAGGCCGAGGCAGGCGG - Intronic
908268734 1:62402845-62402867 CTTTGGGAGGCAGAGGAAGGAGG - Intergenic
908743306 1:67350873-67350895 CTGAGTGTCTCAGAGGCAAGAGG + Exonic
909139016 1:71839452-71839474 CTTTGTGACTCTGAGGTGGGTGG - Intronic
909412333 1:75369259-75369281 CTTTGTGAGGCTGAGGAAGGAGG - Intronic
910457980 1:87418226-87418248 CTGTGTTAGTCAGTGGAATGGGG - Intergenic
910905951 1:92178730-92178752 CTTTGGGAGGCAGAGGAAGGAGG - Intronic
911470285 1:98309677-98309699 CTGTGTGAGGCTGAGGCAGGCGG - Intergenic
911590353 1:99740686-99740708 CTTTGTGACTCCAAGGCAGGAGG + Intronic
911906548 1:103576249-103576271 CTGTGTGACTCAGAGGAAGGAGG - Intronic
911910054 1:103622622-103622644 CCGTGTGACTCATAGGAAGGAGG - Intronic
911913152 1:103661399-103661421 CTGTGTGACTCATAGGAAGGAGG - Intronic
911915302 1:103690549-103690571 CTGTGTGACTCATAGGAAGGAGG + Intronic
911917470 1:103716747-103716769 CCGTGTGACTCATAGGAAGGAGG - Intronic
911920565 1:103755537-103755559 CTGTGTGACTCATAGGAAGGAGG - Intronic
912254414 1:108044482-108044504 CTCTCTGTCTCAGAGGAAGTGGG - Intergenic
914258339 1:145978275-145978297 TGGTGTGACTGAGAGGAAAGGGG + Intronic
914893604 1:151650268-151650290 CTTTGGGAGTCTGAGGAAGGAGG - Intronic
914920630 1:151844944-151844966 CTCTGAGACTGAAAGGAAGGAGG - Intergenic
915250175 1:154582462-154582484 CTGTGTGACTCAGAGGGGCATGG + Exonic
915894452 1:159800721-159800743 TTGTCTGACTCAGTGGAAGTGGG - Intronic
915989536 1:160499910-160499932 CCATGTGATTCAGAGGAAAGAGG - Intronic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
917237638 1:172911927-172911949 CTTTGGGAGTCTGAGGAAGGAGG + Intergenic
918327545 1:183424764-183424786 TTGGGTGACTTAAAGGAAGGAGG - Intergenic
918726266 1:187928439-187928461 CTGTGTTTCTCAGAGGAATGAGG + Intergenic
919176796 1:194028953-194028975 CTTTGTGAGGCCGAGGAAGGTGG - Intergenic
919891301 1:201977092-201977114 CTTTGGGAGGCAGAGGAAGGTGG + Intergenic
920094119 1:203474834-203474856 CTGTGGGAGGCAGAGGCAGGCGG - Intergenic
920129477 1:203720728-203720750 CTGTATCACTCAGGTGAAGGGGG + Exonic
920139448 1:203797212-203797234 CTCTGTGACTCTGGGAAAGGGGG + Exonic
920338285 1:205259332-205259354 CTGCCTGCCTCAGAGGGAGGAGG + Intronic
920955847 1:210619476-210619498 CTCTGGGTCTCAGAGGAAAGGGG + Intronic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
922148197 1:222970263-222970285 CTGTCTGCCTTAGATGAAGGTGG - Intronic
923017020 1:230134712-230134734 CTGTGTGACTGAGAGGAGCTGGG + Intronic
923494415 1:234511978-234512000 CTTTGGGAGTCAGAGGCAGGTGG - Intergenic
923859535 1:237879397-237879419 ATGTATGACTCACAAGAAGGTGG - Intronic
924497440 1:244603760-244603782 CTTTGGGAATCAGAGGCAGGAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063221804 10:3975758-3975780 CTCTGTGACTCAGGGGGTGGGGG - Intergenic
1063377463 10:5562520-5562542 TTGTGAGACTCTGAGGGAGGAGG - Intergenic
1063876283 10:10482786-10482808 CTGTGTGAGTTAGATGAAGGGGG - Intergenic
1064102284 10:12474105-12474127 CTTTGGGAGTCAGAGGAAGAGGG + Intronic
1064195638 10:13242036-13242058 CTGTGAGACGCTGAGGCAGGAGG + Intergenic
1064288319 10:14011763-14011785 CTTTGGGACTCAGAGGTAGGTGG + Intronic
1064568140 10:16664352-16664374 CTGTGTGACTCTTAGGTATGTGG + Intronic
1064998688 10:21318037-21318059 CTGTGAGACTCTGAGGCAGCTGG - Intergenic
1065022894 10:21515644-21515666 CAGTGTGACTGAGAGTAAAGAGG - Exonic
1066401976 10:35085499-35085521 CTTTGGGACACTGAGGAAGGCGG + Intronic
1067708391 10:48628009-48628031 CTCTGAGACTCAAAGAAAGGAGG + Intronic
1067982834 10:51106558-51106580 CTGAGTGAATCTGAGCAAGGCGG - Intronic
1068685108 10:59862241-59862263 CTGTGTGACCCCGAGGCAGGTGG + Intronic
1069374235 10:67777509-67777531 CTTTGTGAGGCAGAGGCAGGAGG - Intergenic
1069729480 10:70601583-70601605 CTGTGGGAGGCAGAGGCAGGTGG + Intronic
1069739526 10:70678714-70678736 CTGCGTGACTCTGAGCAAGCTGG + Intronic
1069926979 10:71857602-71857624 CTGTGGGAGGCAGAGGCAGGTGG - Intergenic
1069950503 10:72015113-72015135 CTGGGTGAGTCAAAGGAAAGCGG - Intergenic
1070193932 10:74139368-74139390 CTGTGGGAGGCTGAGGAAGGAGG + Intronic
1070247856 10:74748829-74748851 CTGTGTGTCTCAGTAGAAGTAGG + Intergenic
1070825621 10:79388789-79388811 CTGTGCCACTCACAGGGAGGTGG - Intronic
1073102414 10:101013425-101013447 CAGGGAGTCTCAGAGGAAGGTGG + Intronic
1073217691 10:101845449-101845471 CCAGGAGACTCAGAGGAAGGAGG + Intergenic
1073419829 10:103415635-103415657 CTGTGTGACTCTGGGCAAGACGG - Intronic
1074069794 10:110055002-110055024 CTTTGGGAGGCAGAGGAAGGCGG - Intronic
1074080567 10:110165173-110165195 CTGTGTGACTCTGGGTAAGTGGG + Intergenic
1074542599 10:114377762-114377784 CTGAGAAACACAGAGGAAGGAGG + Intronic
1074628334 10:115219657-115219679 CTTTGTGAGGCAGAGGCAGGTGG + Intronic
1074874364 10:117602683-117602705 CTAGGTGACCCAGAGGAAGATGG - Intergenic
1075127216 10:119710181-119710203 CTGTGGGAGGCAGAGGCAGGAGG + Intergenic
1075554261 10:123418710-123418732 CTGTGTGAGTCAGAATAAGCTGG + Intergenic
1075656626 10:124166141-124166163 CTTTGGGAGGCAGAGGAAGGAGG + Intergenic
1076207651 10:128615919-128615941 CTGTGGGAGGCAGAGGCAGGCGG + Intergenic
1076669928 10:132114461-132114483 CTGTGGGAGGCAGAGGCAGGAGG - Intronic
1076831835 10:132999310-132999332 CTGGGAGGCTCAGAGGATGGAGG - Intergenic
1076884678 10:133256596-133256618 CTGTGGGAAGCAGAGGCAGGAGG + Intergenic
1076891126 10:133284003-133284025 CTGAGTGACACGGAGGACGGAGG + Intronic
1077152329 11:1077855-1077877 TTGTTTGAGCCAGAGGAAGGTGG - Intergenic
1078401244 11:11029264-11029286 GAGCGTGACTCAGAGGAAAGTGG + Intergenic
1078414645 11:11155611-11155633 CTTTGTGAGGCAGAGGCAGGAGG - Intergenic
1079029991 11:16979455-16979477 CTGTGTGACCTTGAGCAAGGTGG - Intronic
1080462768 11:32470313-32470335 CTTTGGGAATCAGAGGCAGGAGG - Intergenic
1081304244 11:41491998-41492020 CTTTGGGACTCCGAGGCAGGCGG + Intergenic
1081980378 11:47262440-47262462 CTTTGGGAGTCAGAGGCAGGAGG - Intronic
1082053272 11:47790643-47790665 CTGTGGGAGTCCGAGGTAGGAGG + Intronic
1082086951 11:48058153-48058175 CTTTGGGAGTCAGAGGCAGGTGG - Intronic
1083850405 11:65362718-65362740 CTGTGTGGTTCAGATAAAGGAGG + Intergenic
1084011332 11:66350585-66350607 CTTTGTGACGCTGAGGCAGGTGG - Intronic
1084429025 11:69101206-69101228 ATGTGGGACCCAGAGGTAGGAGG - Intergenic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1085290310 11:75394436-75394458 CAGAGTGGCTCAGAGGGAGGTGG - Intergenic
1085662229 11:78378973-78378995 CTGTGTGATTCTGGGGAAGCTGG - Intronic
1086740064 11:90355773-90355795 CTGTGTCACTCTAAGGAAAGAGG + Intergenic
1087537097 11:99462839-99462861 CTTTGTGACGCTGAGGCAGGTGG + Intronic
1088760412 11:112924037-112924059 CTGGGTGAGACAGAGGAGGGTGG + Intergenic
1088885467 11:114002968-114002990 CATTGCCACTCAGAGGAAGGGGG - Intergenic
1089514174 11:119021130-119021152 CTGTGGGAGGCAGAGGCAGGTGG - Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1090223540 11:125053296-125053318 CTGTATGACACACAGGAAGTGGG + Intergenic
1091454196 12:593472-593494 CTGTGGGACGCTGAGGTAGGAGG + Intronic
1091544838 12:1494725-1494747 CTGTGTGATTCAGAGAATTGGGG + Exonic
1091734972 12:2913505-2913527 CTTTGGGAGGCAGAGGAAGGAGG - Intronic
1094215622 12:27939117-27939139 CTTTGGGACTCAAAGGTAGGAGG + Intergenic
1094432458 12:30384753-30384775 CTGATTGACTTTGAGGAAGGAGG + Intergenic
1095742622 12:45623477-45623499 CTGTGGGATACATAGGAAGGAGG + Intergenic
1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG + Intronic
1096707620 12:53432288-53432310 CTTTGGGACACTGAGGAAGGAGG - Intergenic
1096757551 12:53812802-53812824 CTTTGGGACTCTGAGGCAGGAGG - Intergenic
1096837694 12:54361612-54361634 CTGTGGGAGGCAGAGGCAGGTGG - Intergenic
1098378674 12:69844651-69844673 CTGTGTGACTCTGGGCAAGCTGG + Intronic
1099719011 12:86337351-86337373 CTTTGAGAGTCCGAGGAAGGTGG + Intronic
1100194649 12:92230871-92230893 CTTTGGGAGTCCGAGGAAGGTGG - Intergenic
1100450182 12:94698400-94698422 CTTTGTGAGGCAGAGGCAGGAGG + Intergenic
1100676746 12:96877057-96877079 CTGCGTGTAGCAGAGGAAGGGGG - Intergenic
1100916663 12:99431669-99431691 CATTCTGACTAAGAGGAAGGTGG + Intronic
1101181103 12:102218876-102218898 GTGTGAGAAGCAGAGGAAGGAGG - Intergenic
1101465156 12:104940898-104940920 CTCTGTCACTCGGAGGCAGGCGG - Intronic
1102004238 12:109578865-109578887 CTCAGTGTCTCAGAGGAAAGTGG + Intronic
1102419996 12:112795981-112796003 CTGTATGACTCACAAGAGGGAGG + Intronic
1102512353 12:113424263-113424285 CTTTGTGAGGCAGAGGCAGGCGG - Intronic
1102896829 12:116604837-116604859 TTGGGTGACTCCGAGGAGGGCGG + Intergenic
1103088003 12:118076900-118076922 CTTTGGGAGTCAGAGGCAGGAGG - Intronic
1103559414 12:121785154-121785176 CTGACTGACTCACAGGCAGGTGG + Intronic
1103839323 12:123849980-123850002 CTGTGTTTCTCAGAGCCAGGAGG + Intronic
1104313294 12:127674610-127674632 CTGTGTCCCTCAGAAGCAGGGGG - Intergenic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1105242429 13:18620152-18620174 CTGTGTGACCCTGAGGTGGGTGG + Intergenic
1105621596 13:22072720-22072742 CAGTGTGAGCCAGTGGAAGGAGG - Intergenic
1105899118 13:24741399-24741421 ATGAGTGACTCACGGGAAGGAGG + Intergenic
1106869311 13:34001658-34001680 CTCTGTGACTGAGAGATAGGTGG + Intergenic
1107152895 13:37132404-37132426 CTAAGTGACTCACAGGCAGGTGG - Intergenic
1107891967 13:44921763-44921785 CTTTGGGATTCAGAGGAAGCGGG - Intergenic
1107966490 13:45602804-45602826 GTGTGTGGCTCAGAGCAGGGTGG - Intronic
1108225013 13:48280325-48280347 CTTTGTGAGTTCGAGGAAGGTGG - Intergenic
1112022971 13:95387696-95387718 CTTTGAGACACTGAGGAAGGAGG - Intergenic
1112349234 13:98619068-98619090 CCCTGTGCCTCAGAGGAAGTTGG - Intergenic
1112563419 13:100533073-100533095 CTGTGTTCCTCAGAGAAGGGTGG - Intronic
1112764852 13:102730109-102730131 TTGTGGGACTTACAGGAAGGTGG + Exonic
1112984765 13:105434694-105434716 CTATCTGACTCAGAGAAAAGGGG - Intergenic
1113210758 13:107977296-107977318 CTTTGTGACAGAGAAGAAGGAGG - Intergenic
1113922132 13:113919190-113919212 CTGGTTGACTCAGAGGCTGGTGG - Intergenic
1114790268 14:25650118-25650140 CTTTGTGAGGCAGAGGCAGGAGG - Intergenic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1117403503 14:55379290-55379312 CTGTGGGAGGCAGAGGAGGGCGG + Intronic
1118738460 14:68719983-68720005 GTTAGTGACTCAGAGGCAGGAGG - Intronic
1118740807 14:68738023-68738045 CTGAGTGGCTCAGTGGGAGGAGG - Intergenic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1119386318 14:74259931-74259953 CTGGGGGACTCAGAGCAGGGTGG + Intronic
1120306801 14:82781086-82781108 CTTTGGGAGTCCGAGGAAGGTGG - Intergenic
1120915219 14:89704447-89704469 CTTTGGGAGTCAGAGGCAGGTGG - Intergenic
1121483528 14:94296101-94296123 TTGTGTGGATCAGATGAAGGGGG + Intergenic
1122090400 14:99334663-99334685 CTGTGTGATTTAGGGGAAAGCGG + Intergenic
1122143520 14:99675920-99675942 CTGTGGGACCCTGAGGAGGGAGG + Exonic
1122292632 14:100687808-100687830 CTGTGTGAACCAGAGAAAGAGGG - Intergenic
1122472062 14:101975517-101975539 CTGTGTGACTTTGGGCAAGGCGG - Intronic
1122847167 14:104506336-104506358 GTGTGTGTCTGAGAGGAGGGCGG - Intronic
1202852335 14_GL000225v1_random:29751-29773 CGGAGTGACGAAGAGGAAGGGGG - Intergenic
1123432292 15:20228979-20229001 CTTTGGGAGTCCGAGGAAGGTGG + Intergenic
1125727107 15:41873760-41873782 CTGTGGGACTCTCAGGGAGGCGG - Intronic
1126559354 15:50026432-50026454 CTGGGTGATTCAGATGCAGGTGG + Intronic
1127135916 15:55923402-55923424 CTTTGGGAGTCAGAGGCAGGCGG + Intronic
1127327248 15:57907558-57907580 CTTTGTGCCTCAGAGTAAGATGG + Intergenic
1127481858 15:59385103-59385125 CTGTGGGAGGCAGAGGAGGGAGG - Intronic
1127800456 15:62472891-62472913 CTGTGTGCAGCTGAGGAAGGGGG + Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1129317530 15:74754359-74754381 CTTTGGGAGTCCGAGGAAGGTGG + Intronic
1129371444 15:75098420-75098442 CTCTGTGACACAGGGGAAAGAGG + Intronic
1129462736 15:75707998-75708020 CTGTGTGACTCTGAACAAGCAGG + Intronic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1129722138 15:77883418-77883440 CTGTGTGACTCTGAACAAGCAGG - Intergenic
1129874906 15:78968157-78968179 CTGTGAGAGGCAGAGGGAGGAGG - Intronic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131088832 15:89603331-89603353 CTTTGGGAGTCAGAGGAGGGAGG + Intronic
1132220501 15:100101622-100101644 CTGTGTGTGTCAGAGGATGGGGG - Intronic
1132370836 15:101296908-101296930 CTGTGGGAGTCTGAGGCAGGTGG - Intergenic
1132416255 15:101621091-101621113 CTGGGAGACTCCGAGGATGGGGG - Intergenic
1132631512 16:919884-919906 CTGACTGCCTCGGAGGAAGGGGG - Intronic
1132722568 16:1323964-1323986 CAGTGTGACCCTGAGGATGGGGG - Intronic
1133233793 16:4378525-4378547 CTCACTGACTCAGAGGACGGCGG - Intronic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1133646419 16:7769031-7769053 CTGTGTACCCCAGAGGTAGGTGG - Intergenic
1135376882 16:21954798-21954820 CTTTGGGAGTCAGAGGCAGGCGG + Intronic
1136849836 16:33603845-33603867 CTTTGGGAGACAGAGGAAGGAGG - Intergenic
1137592857 16:49704333-49704355 CTGAGGGACCCAGAGGAGGGAGG - Intronic
1137721188 16:50628408-50628430 CTGTGGGACTTACAGGCAGGAGG + Intronic
1139667286 16:68466440-68466462 GTCAGTGACTCAGAGCAAGGTGG + Intergenic
1140109079 16:71987745-71987767 CTCTGGGACTCCGAGGCAGGAGG - Intronic
1140193873 16:72840649-72840671 CTGTGGGCTTCAGAGTAAGGTGG - Intronic
1142107853 16:88315868-88315890 GTGTGTGACTCAGCAGGAGGGGG - Intergenic
1142275204 16:89114783-89114805 GTGCATGTCTCAGAGGAAGGCGG + Intronic
1203111447 16_KI270728v1_random:1452298-1452320 CTTTGGGAGACAGAGGAAGGAGG - Intergenic
1142542677 17:672867-672889 CTGTGGGAGGCTGAGGAAGGTGG + Intronic
1142750175 17:1982798-1982820 CTTGCTGACCCAGAGGAAGGAGG + Intronic
1142812781 17:2403021-2403043 CTTCGTGAACCAGAGGAAGGGGG + Intergenic
1142816733 17:2432322-2432344 CTGTGGGAGGCCGAGGAAGGTGG + Intronic
1143965043 17:10751013-10751035 CTTTGTGAGGCAGAGGCAGGAGG + Intergenic
1144725167 17:17498223-17498245 CTGTGGGAGGCACAGGAAGGCGG - Intergenic
1145212033 17:21020965-21020987 CTGTGGGCCTTAGGGGAAGGTGG + Intronic
1145903600 17:28504520-28504542 CTGTGAGTCCCAGAGAAAGGTGG + Intronic
1145970224 17:28951807-28951829 CTGTGTTATGGAGAGGAAGGGGG - Intronic
1146848225 17:36198784-36198806 CATTGTGGCTCAGAGGAAAGAGG + Intronic
1146851736 17:36227947-36227969 CTTTGAGACTCAGAGGCAGACGG - Intronic
1146867646 17:36351820-36351842 CTTTGAGACTCAGAGGCAGACGG - Intronic
1147070520 17:37952437-37952459 CTTTGAGACTCAGAGGCAGACGG - Intergenic
1147082046 17:38031959-38031981 CTTTGAGACTCAGAGGCAGACGG - Intronic
1147097993 17:38155924-38155946 CTTTGAGACTCAGAGGCAGACGG - Intergenic
1147853669 17:43461832-43461854 CTTTGGGACTCTGAGGCAGGTGG + Intergenic
1147995778 17:44359732-44359754 CTCTGGGACTCAGATGGAGGGGG - Intronic
1148003279 17:44403460-44403482 CTTTGTGACACAGAGGCAGGAGG - Intronic
1148160297 17:45445959-45445981 CTGTGAGGCCCAGAGGGAGGGGG - Intronic
1148388345 17:47252845-47252867 TTGTGTGTCTCAGAAGAGGGTGG + Intergenic
1148396613 17:47313215-47313237 CTGTGGGAGGCCGAGGAAGGTGG - Intronic
1148442446 17:47718481-47718503 CTGAGTGACAGAGAGGAAGGAGG - Intergenic
1150362175 17:64546025-64546047 CTGTGTGACACAGAGTGATGTGG - Intronic
1150391589 17:64792838-64792860 CTGTGAGGCCCAGAGGGAGGGGG - Intergenic
1150410410 17:64936976-64936998 CTGTGAGGCCCAGAGGGAGGGGG - Intergenic
1150566026 17:66340942-66340964 CTGTGGGAATCAGAGGAGTGTGG + Intronic
1151342565 17:73481247-73481269 CTGTGTCCCTCGGAGGAGGGGGG + Intronic
1151486385 17:74403689-74403711 CTGGGAGGCTCAGAGGAAGGAGG - Intergenic
1151997863 17:77621989-77622011 CTTTGGGAGGCAGAGGAAGGTGG - Intergenic
1152029070 17:77830630-77830652 CACTGTGACTCAGAGGAGGCCGG - Intergenic
1152379877 17:79936963-79936985 CACTTTGCCTCAGAGGAAGGAGG - Exonic
1152806307 17:82358058-82358080 CTGTGGGAGGCAGAGGCAGGCGG + Intergenic
1152890702 17:82880255-82880277 CTGTGGGAGGCAGAGGCAGGAGG - Intronic
1153093511 18:1374671-1374693 CTGTGTGAATTAGATAAAGGAGG + Intergenic
1154446520 18:14439726-14439748 CTGTGTGACCCTGAGGTGGGTGG - Intergenic
1154935665 18:21053590-21053612 CTTTGGGACACAGAGGCAGGAGG + Intronic
1155526114 18:26717746-26717768 CTTTGTGAGGCAGAGGCAGGAGG - Intergenic
1156260331 18:35440167-35440189 CTCTGTGACTCTGAGGAAAACGG + Intergenic
1158448163 18:57539298-57539320 TTGTGGGAGTCAGAGGATGGAGG - Intergenic
1160038279 18:75321059-75321081 CTTTGGGAGGCAGAGGAAGGTGG - Intergenic
1160717669 19:583716-583738 CTGTGTGGCTCTGAGGCACGGGG - Intergenic
1160735740 19:661641-661663 CTCTGTGACCCAGAGACAGGCGG + Intronic
1160801330 19:971222-971244 CTTTGGGAGTCAGAGGCAGGAGG + Intronic
1161239098 19:3211840-3211862 CTCTGGGAGTCAGAGGCAGGAGG + Intergenic
1161280021 19:3441051-3441073 CTGTGGGAAGCAGAGGCAGGAGG - Intronic
1161318651 19:3631134-3631156 CCGTGTCACTCAGCGGAGGGAGG + Exonic
1161875022 19:6901723-6901745 CTGTGTGCCTGGGAAGAAGGGGG + Intronic
1162163523 19:8737240-8737262 CTTTGGGAGGCAGAGGAAGGAGG + Intergenic
1162453905 19:10771034-10771056 CTGTGGGACGCCGAGGAGGGTGG - Intronic
1162527797 19:11216779-11216801 CTGTGGGACTGAGAGGAAAGGGG - Intronic
1162623718 19:11865782-11865804 CTTTGTGACTCTGAGGCAGGTGG + Intronic
1162996684 19:14340228-14340250 CTTTGTGAGGCAGAGGCAGGAGG + Intergenic
1163340522 19:16703535-16703557 CTTTGTGAGGCAGAGGAAGGAGG + Intergenic
1163599602 19:18240948-18240970 CTGTGTGACTCCCAGCAAGCAGG - Intronic
1163774381 19:19209305-19209327 CTTTGGGAGTCAGAGGCAGGAGG - Intergenic
1163879379 19:19903825-19903847 CTGTGGGAGGCAGAGGCAGGCGG + Intronic
1164311192 19:24048039-24048061 CTCTGTCACCCAGAGGTAGGTGG + Intronic
1165021471 19:32927846-32927868 CTGTGTGAAGCTGAGGCAGGAGG - Intronic
1166058323 19:40307621-40307643 CTGTGGGAGACAGAGGCAGGTGG - Intergenic
1166682339 19:44776810-44776832 CTCTCTGTCTCCGAGGAAGGAGG - Intergenic
1166702966 19:44892699-44892721 CTAAGAGACTCAGAGAAAGGAGG - Intronic
1167209441 19:48123974-48123996 GTGTGTGTCAGAGAGGAAGGAGG + Intronic
1167592514 19:50411891-50411913 CTTTGTGACACTGAGGAGGGAGG + Intronic
1167726410 19:51216056-51216078 TTGGGTGACACAGAGAAAGGAGG - Intergenic
1168023419 19:53626320-53626342 CTGTGGGAGGCAGAGGCAGGTGG - Intergenic
1168265126 19:55219111-55219133 CTTTGAGACGCAGAGGCAGGTGG - Intergenic
925085237 2:1102485-1102507 CTGCGTGTCTGAGAGGAAGGAGG + Intronic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925700247 2:6629500-6629522 ATATGGGACTCAGAGGGAGGGGG - Intergenic
925751159 2:7091344-7091366 GTGTGGGACTCAGAGGACTGGGG - Intergenic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
926138824 2:10356453-10356475 CGGTGGGACTCAGAGGGTGGTGG + Intronic
927410308 2:22817468-22817490 GTGTCAGAGTCAGAGGAAGGAGG - Intergenic
928639760 2:33285688-33285710 CTTTGGGAGTCTGAGGAAGGTGG - Intronic
929326341 2:40615999-40616021 CTTTGGGATTCAGAGGCAGGTGG - Intergenic
929326987 2:40626157-40626179 CTGTGTGACAAAGATCAAGGAGG - Intergenic
930261674 2:49154245-49154267 CTGTGAGTATCAGAGGGAGGGGG - Exonic
930998484 2:57752105-57752127 CTATGGAATTCAGAGGAAGGAGG + Intergenic
931283278 2:60812101-60812123 CTGTGGGAGTCTGAGGCAGGTGG - Intergenic
931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG + Intergenic
931767889 2:65472930-65472952 CTGTGAGTGTCAGAGGATGGAGG - Intergenic
931799734 2:65747224-65747246 CTGTGTGTCTCTCAGGGAGGGGG + Intergenic
932413926 2:71562638-71562660 CTGTGGGACTCCCAGGGAGGAGG + Intronic
932434355 2:71694547-71694569 CTGTGTGGGTCTGAGGAAGGTGG - Intergenic
932683880 2:73851457-73851479 CTGTGGAATTCAGAGGAAGGAGG + Intronic
933628878 2:84633828-84633850 TTGTGGGAATCGGAGGAAGGGGG + Intronic
933703551 2:85273356-85273378 GTGTGTGGCACAGAGGAAGTGGG - Intronic
934856074 2:97731229-97731251 CTGTGGAAGTCAGAGGCAGGTGG - Intronic
935242905 2:101193608-101193630 CTCTGTGAATCCGAGGCAGGAGG + Intronic
935687877 2:105700297-105700319 CTGTGGAGCTCACAGGAAGGAGG - Intergenic
935948466 2:108307272-108307294 CTGTGTGAGTCTGAAGAAGGAGG - Intronic
936726597 2:115325779-115325801 ATGTCTAACTCAGAGGAAGATGG + Intronic
937249197 2:120512545-120512567 CTGTGGGTGTCAGAGGGAGGAGG + Intergenic
937755033 2:125526796-125526818 CTGTGGGAGGCCGAGGAAGGCGG + Intergenic
939881476 2:147636210-147636232 CTTTGGGAGTCAGAGGCAGGTGG - Intergenic
939885408 2:147676093-147676115 CTGTGAGAGTCAAAGGAAGCTGG - Intergenic
939903943 2:147886965-147886987 CTTTGGGAGTCAGAGGCAGGAGG + Intronic
940376280 2:152962656-152962678 CTCTGTGACACAGTGGAAAGGGG + Intergenic
941677373 2:168357850-168357872 CTGTGTGAGGCCAAGGAAGGAGG - Intergenic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
943434015 2:187840750-187840772 CTTTGGGACACTGAGGAAGGCGG - Intergenic
945018827 2:205550293-205550315 CTGTGGAAGTCTGAGGAAGGAGG - Intronic
945186622 2:207146416-207146438 TGGTCTGACTCAGGGGAAGGGGG - Intronic
946406754 2:219496019-219496041 CTGCCTGAGTCAGAGGGAGGCGG + Intronic
946486956 2:220109974-220109996 CTGGGAGACTCAAAGGCAGGGGG - Intergenic
946711791 2:222514439-222514461 CTGTGGGAGGCAGAGGCAGGAGG - Intronic
946881902 2:224185016-224185038 CTTTGTGAGGCAGAGGAGGGTGG - Intergenic
947370514 2:229440745-229440767 CTGGGTGATTCAGAGGAAATGGG - Intronic
947903348 2:233741223-233741245 CAGTGTCACTCAGAGGTAGTGGG - Intronic
948118108 2:235508882-235508904 CAGGGTTACACAGAGGAAGGTGG + Intronic
948433204 2:237933865-237933887 CTGTGTGATTTGGAGGATGGCGG - Intergenic
1169076718 20:2764529-2764551 CTGTGGGAGTCTGAGGCAGGAGG - Intergenic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1170122214 20:12923630-12923652 CTGTGTGCCAAAGAGGCAGGAGG + Intergenic
1170142406 20:13138071-13138093 CTGAGTAACTCACAGGAAAGGGG - Intronic
1170227915 20:14012148-14012170 CTTTGGGACGCAGAGGAGGGTGG - Intronic
1170841443 20:19927791-19927813 CTGTGGGAGTCTGAGGCAGGAGG - Intronic
1172142764 20:32734992-32735014 CTTTGCGAGTCTGAGGAAGGTGG + Intronic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1173086597 20:39925208-39925230 CTGTGGGAGAGAGAGGAAGGTGG + Intergenic
1173612525 20:44380535-44380557 CTTTGTGAGGCAGAGGCAGGAGG - Intronic
1173708249 20:45130548-45130570 TTGTCTGGCTCAGTGGAAGGTGG - Intergenic
1174424227 20:50420699-50420721 CTCTGGGACCCAGAGCAAGGTGG - Intergenic
1174466318 20:50720318-50720340 CTGTGGGAGGCAGAGGCAGGTGG + Intergenic
1174548091 20:51341643-51341665 CAGGGTGGCTCAGAGGAAGTGGG + Intergenic
1174850377 20:53988209-53988231 CTATGTGACTCTGAGTAAGTGGG - Intronic
1175106550 20:56619151-56619173 CTTTGTGACGCTGAGGCAGGCGG + Intergenic
1175193040 20:57224186-57224208 CTGAGTCACTCTGAGGAAGAGGG - Intronic
1176645753 21:9347835-9347857 CTGTGTGAGTCCAAGGGAGGTGG + Intergenic
1177141386 21:17361597-17361619 CTTTGAGAGTCAGAGGCAGGAGG + Intergenic
1178076616 21:29018745-29018767 CTTTGGGAGGCAGAGGAAGGGGG + Intronic
1178319448 21:31594176-31594198 CTTTGTGAGGCAGAGGCAGGTGG - Intergenic
1178473972 21:32920250-32920272 CTGTGGGAGGCAGAGGCAGGAGG - Intergenic
1179138020 21:38697664-38697686 CTGTATGACTCAGGGAAAGATGG + Intergenic
1180537439 22:16406070-16406092 CTGTTTGACTCAGTGGCAGCTGG + Intergenic
1181330526 22:22087199-22087221 GTGGGTGACTCTGAGGACGGAGG - Intergenic
1182045415 22:27270446-27270468 CAATATGCCTCAGAGGAAGGAGG + Intergenic
1182284249 22:29234940-29234962 CTGTGGGAGGCCGAGGAAGGTGG + Intronic
1183469904 22:37999639-37999661 CTGTGGGACGCAGAGGCAGTGGG + Intronic
1183506221 22:38210385-38210407 CAGTGTGACTCAGGCCAAGGTGG - Intronic
1183640594 22:39090262-39090284 CTGTGTCACTCTGGGGCAGGGGG + Intergenic
1184145951 22:42610657-42610679 CTTTGTGAGGCAGAGGCAGGAGG + Intronic
1184707343 22:46223704-46223726 CTGTGGGAGGCAGAGGAGGGCGG + Intronic
1185132561 22:49047435-49047457 CTGTGTGACTCAGAGAGCTGAGG - Intergenic
1185153719 22:49180679-49180701 CAGTGTGAGTCAGGAGAAGGTGG - Intergenic
1185343880 22:50303068-50303090 CTGTGTGACTCAGACGTGGTAGG - Intronic
949168476 3:969470-969492 CTGTGTGACCCAGGGCAAGTCGG - Intergenic
950161369 3:10763643-10763665 CAGTGTGACTCAGAGAACCGGGG - Intergenic
950889341 3:16389105-16389127 CTATGTAAATCAGAGGATGGTGG - Intronic
951606886 3:24444825-24444847 CTTTGGGACGCTGAGGAAGGTGG - Intronic
953108244 3:39907006-39907028 CTGTGTGACTCAGATAGAGGAGG + Intronic
953393686 3:42549481-42549503 CTGTGTGAGGCACAGGAAGCAGG - Intronic
953504483 3:43470868-43470890 CTTTGGGAATCAGAGGCAGGTGG - Intronic
953634890 3:44654463-44654485 CTGCCTGACACATAGGAAGGAGG - Intronic
953999910 3:47548142-47548164 CTGTGGGAAGCAGAGGAGGGAGG + Intergenic
954127793 3:48542101-48542123 CTGTGGGAGGCAGAGGCAGGCGG + Intronic
954166303 3:48761038-48761060 CTTTGGGAGGCAGAGGAAGGAGG + Intronic
954612072 3:51949907-51949929 CTTTGGGAGGCAGAGGAAGGAGG - Intergenic
955520767 3:59773329-59773351 CTGTGGGAGTCACAGAAAGGGGG + Intronic
956148405 3:66215442-66215464 CTGTGTGAGACTGAGGTAGGAGG - Intronic
956489776 3:69758412-69758434 CTTTGGGACTCTGAGGCAGGAGG - Intronic
957691603 3:83577911-83577933 CTTTGGGAGGCAGAGGAAGGCGG + Intergenic
960081191 3:113542164-113542186 CTGTGGGAGTCTGAGGCAGGTGG - Intronic
960275838 3:115728273-115728295 CAGTGTGGTTCAGAGGCAGGAGG - Intergenic
961356031 3:126340613-126340635 CTGTGTGCCTTAGGGGCAGGCGG + Intergenic
961528030 3:127520062-127520084 CTTTGGGAGTCAGAGGCAGGCGG - Intergenic
961791946 3:129382565-129382587 CTGTAAGATTCAGAGGAGGGAGG + Intergenic
965632454 3:170747154-170747176 CTGTGTCACTGAGCAGAAGGGGG + Intronic
966754918 3:183360322-183360344 CTCTGGGACTCTGAGGCAGGAGG + Intronic
966861858 3:184234946-184234968 GGGTGTGTCTCAGAGGATGGAGG + Intronic
967670684 3:192231524-192231546 CTGTGGGAGGCAGAGGCAGGTGG + Intronic
968482507 4:842197-842219 GTGTGTTACTCAGAGGCTGGTGG - Intergenic
968492478 4:897560-897582 GTGAGGGGCTCAGAGGAAGGAGG + Intronic
969126491 4:4952017-4952039 CTGTGTTTCTCAGAGGAACTTGG + Intergenic
970393542 4:15641781-15641803 CTTTGGGACGCAGAGGCAGGCGG + Intronic
970436362 4:16039492-16039514 CTTTGGGACACAGAGGCAGGTGG + Intronic
970853241 4:20626563-20626585 CTATGTAACTCAGAGACAGGTGG - Intergenic
971839316 4:31813076-31813098 CTGTGGGAAGCAGAGGTAGGAGG + Intergenic
972573242 4:40329431-40329453 CTTTGGGACTCTGAGGCAGGTGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973948722 4:55988414-55988436 CTTTGGGAGTCAGAGGCAGGAGG + Intronic
974453654 4:62098039-62098061 CAGTGTGGCTGAGAGGAATGTGG - Intergenic
975170372 4:71225675-71225697 CTGTGTGTGTCAGAGGTGGGTGG + Intronic
975487523 4:74950416-74950438 CAGAGTGACTCAGAGGAAAGGGG - Intronic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
976296314 4:83475956-83475978 CTTTGGGAAGCAGAGGAAGGAGG + Intronic
976403066 4:84629682-84629704 TTCTCTGACTTAGAGGAAGGGGG - Intronic
976804218 4:89027785-89027807 CTAAGTGACTAATAGGAAGGTGG + Intronic
977524545 4:98127993-98128015 CTGTGTATCTCAGAAGAAGAAGG - Intronic
978040200 4:104051122-104051144 AGGTGTGAATCAAAGGAAGGAGG - Intergenic
978099017 4:104814168-104814190 CTTTGGGAGTCAGAGGCAGGCGG + Intergenic
978705436 4:111703760-111703782 TTGTATGACTCAGAGGAAGAGGG + Intergenic
979410958 4:120379021-120379043 CTGAGTCAATCAAAGGAAGGAGG + Intergenic
981586671 4:146310877-146310899 CAGTGTGAAACAGGGGAAGGGGG + Intronic
981690168 4:147499297-147499319 CTTTGTGAAGCAGAGGAAGGAGG - Intronic
981730552 4:147892669-147892691 TTTGGAGACTCAGAGGAAGGGGG + Intronic
983320234 4:166187551-166187573 CTGTGTAGCTCAGAGCAATGAGG - Intergenic
984842652 4:184082398-184082420 CTGTGAGACTCAGAGAACAGAGG - Intergenic
986084090 5:4425670-4425692 CTGTGTAACACAAAGGAATGAGG + Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
986552002 5:8967134-8967156 ATGTGAGAGTCAGAGAAAGGTGG + Intergenic
986998300 5:13632675-13632697 CTGTGTGAAACAGAGCAAGAGGG - Intergenic
988440163 5:31224785-31224807 CTTTGGGACGCTGAGGAAGGTGG - Intronic
989592012 5:43121085-43121107 CTGAGGGACGGAGAGGAAGGAGG + Intronic
990486638 5:56265713-56265735 CTTTGGGACACAGAGGCAGGAGG - Intergenic
991771666 5:70046644-70046666 CTGTGGGAGTCCGAGGCAGGTGG - Intergenic
991850957 5:70922051-70922073 CTGTGGGAGTCCGAGGCAGGTGG - Intergenic
992565184 5:77988931-77988953 CTGTCTGACTCTGAGCAAGGTGG + Intergenic
993289235 5:86043137-86043159 CTCTGTATCTCAGAGGAAGTAGG + Intergenic
994648221 5:102496254-102496276 CTGGTTGACTCACAGGAAGCAGG + Intronic
994656525 5:102600869-102600891 CTGTGTGGTTCAGGGAAAGGGGG + Intergenic
994772172 5:103997161-103997183 CTTTGAGACTCTGAGGCAGGAGG + Intergenic
996148505 5:120005815-120005837 CTGTGTTACTCAAAGAAAGGTGG + Intergenic
996887909 5:128380775-128380797 CTGTGAGACTCAGAATAAAGAGG - Intronic
997210363 5:132073503-132073525 CTGTGCCCCTCAGAGGGAGGGGG + Intergenic
997263140 5:132478820-132478842 CTGGCTGTCACAGAGGAAGGAGG - Intergenic
997313594 5:132912602-132912624 CTTTGGGAGTCCGAGGAAGGAGG - Intronic
997642384 5:135457767-135457789 CATTTTGACTCAGAGAAAGGAGG - Intergenic
997659159 5:135576779-135576801 CTGGGTGACTCAGGGTAAGCTGG + Intronic
998165806 5:139842891-139842913 CTGGTCAACTCAGAGGAAGGAGG - Exonic
998278031 5:140777002-140777024 CTGTGGGAAGCAGAGGCAGGTGG + Intergenic
998480268 5:142457450-142457472 CTGTGTGACTTTGTGGAAGAAGG - Intergenic
998700840 5:144697881-144697903 CTGTGTGGCTTAGGGGAAGATGG + Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001315796 5:170640463-170640485 CTGTGTGCCCCAGATGATGGTGG + Intronic
1001329062 5:170749458-170749480 CAGAGGGATTCAGAGGAAGGTGG - Intergenic
1001414554 5:171535800-171535822 CTGAGTGAGTCAGGGGAAGAAGG + Intergenic
1001569217 5:172719167-172719189 CTTTTTGACCCACAGGAAGGAGG + Intergenic
1001963882 5:175896622-175896644 CTGTGTGACTCTGAGCCTGGTGG - Intergenic
1001969134 5:175939579-175939601 CTTTCTCACTCAGAGAAAGGGGG + Intronic
1002248306 5:177904164-177904186 CTTTCTCACTCAGAGAAAGGGGG - Intergenic
1003180133 6:3784015-3784037 CTTTGTGAGGCAGAGGCAGGCGG - Intergenic
1003332127 6:5137956-5137978 CTGTGTTACTCAGAGGCCTGAGG + Intronic
1003662920 6:8080462-8080484 GTGTGTGACTCAGATGAAGGAGG + Intronic
1004124757 6:12862416-12862438 CTGGGAGACTGTGAGGAAGGAGG + Intronic
1004393010 6:15225017-15225039 CTTTGGGAGGCAGAGGAAGGTGG + Intergenic
1004562854 6:16767399-16767421 CTGTGTTACACAGTGTAAGGGGG - Intergenic
1004922107 6:20385489-20385511 CTTTGGGAGGCAGAGGAAGGAGG - Intergenic
1005943163 6:30576530-30576552 CTTTGTGAGGCAGAGGCAGGCGG - Intronic
1006030217 6:31172254-31172276 CTGAGTCCCCCAGAGGAAGGAGG - Intronic
1006644058 6:35504070-35504092 CTTTGGGAGTCAGAGGAGGGAGG + Intronic
1006977534 6:38117295-38117317 CTTTGTGAGGCAGAGGCAGGAGG - Intronic
1007418204 6:41704398-41704420 CTCACTGACTCTGAGGAAGGTGG - Intronic
1007694886 6:43725703-43725725 CTGTGAGACTCAGGGGAGGTGGG - Intergenic
1007851825 6:44810525-44810547 GAGTGTGACTCAGAGAAAAGAGG + Intronic
1009380234 6:63018688-63018710 GTGTGTGTGTCAGAGAAAGGGGG + Intergenic
1009504271 6:64455153-64455175 CTTTGTGAGGCAGAGGAGGGAGG - Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1012395991 6:98797806-98797828 TTGTGTGACTCAGAAGATGAAGG - Intergenic
1013462518 6:110388709-110388731 GTCTGTGACCCAGAGGAACGAGG - Intergenic
1013627317 6:111950955-111950977 CTGATTGACACAGAGGAAGAGGG + Intergenic
1014372954 6:120636099-120636121 TAGTGTGACTAAGAGTAAGGAGG - Intergenic
1014989010 6:128050782-128050804 CTTTGGGAGGCAGAGGAAGGAGG - Intronic
1016898368 6:149076081-149076103 CTTTCTGCCTCAGAGGACGGGGG + Exonic
1017312068 6:152986072-152986094 CTTTGGGAGTCAGAGGCAGGAGG + Intergenic
1017769217 6:157632046-157632068 CTGTGGGACTCAGTGGCAGGGGG - Intronic
1017838879 6:158205213-158205235 TTGTGTGACTTAGAAAAAGGTGG + Intergenic
1019325290 7:435261-435283 CTGTGTGACATGGAGGGAGGTGG - Intergenic
1019852811 7:3576337-3576359 CTGTGTGACTCTGAGCTAGGTGG + Intronic
1020682327 7:11252924-11252946 CTGGGGAACTCAGAGGAAAGGGG - Intergenic
1020932823 7:14420953-14420975 ATCTGTGACGCAGTGGAAGGGGG - Intronic
1021512965 7:21454599-21454621 CTGTGTGAGTCCTATGAAGGGGG + Intronic
1023059227 7:36312879-36312901 TTGTGTGAACCTGAGGAAGGAGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023375843 7:39554086-39554108 CTTTGGGATTCAGAGGTAGGAGG + Intergenic
1024265318 7:47601852-47601874 CTGTGTGATTCAGAAGCAGCTGG + Intergenic
1024405683 7:48976593-48976615 CAGTCTGACTCTGAGGAAGGTGG - Intergenic
1025074258 7:55928886-55928908 CTGTGTGAGACTGAGGCAGGTGG + Intronic
1026114609 7:67485754-67485776 CTTTGTGAGGCAGAGGCAGGTGG - Intergenic
1026140287 7:67699805-67699827 ATGTGGGAATCAGAGGAAGATGG - Intergenic
1026153169 7:67804974-67804996 CTTTGTGACGCTGAGGCAGGAGG + Intergenic
1026261530 7:68759707-68759729 CTGTGTGATGCAGAGCAAGAAGG - Intergenic
1026367902 7:69667812-69667834 CTGTGGGCCTCAGAGGTAGGAGG - Intronic
1026822587 7:73559376-73559398 CTGTGGGAGGCCGAGGAAGGAGG - Intergenic
1027363099 7:77429712-77429734 GTGTATGTCTAAGAGGAAGGAGG - Intergenic
1027793540 7:82662213-82662235 CTGGGTGGCTTACAGGAAGGTGG - Intergenic
1028741691 7:94282591-94282613 CTGTGTAAAGCAGAGTAAGGGGG - Intergenic
1029187501 7:98749847-98749869 CTTTGGGACGCAGAGGCAGGAGG + Intergenic
1029283515 7:99451361-99451383 CTTTGGGAGGCAGAGGAAGGCGG + Intronic
1029603108 7:101581534-101581556 CTTTGGGACCCCGAGGAAGGAGG + Intergenic
1029987894 7:104938395-104938417 CTTTGTGAGGCCGAGGAAGGAGG + Intergenic
1031543792 7:123027823-123027845 CTGTGGGAGGCAGAGGCAGGAGG - Intergenic
1032283342 7:130523712-130523734 CCCAGTGACTCAGAGGAAGTGGG + Intronic
1032284084 7:130527937-130527959 CCCAGTGACTCAGAGGAAGTGGG + Intronic
1032316573 7:130843757-130843779 CTGAGGGACAAAGAGGAAGGAGG - Intergenic
1032321651 7:130891317-130891339 CTGTGTGGTGCAGAGGAGGGAGG + Intergenic
1032504736 7:132426387-132426409 CTGTGTGCCTCAGACAGAGGTGG - Intronic
1033047843 7:137978692-137978714 CTGGGTGAATGAGAGGAAGGGGG + Intronic
1033123312 7:138685425-138685447 CTGAGTGGCTGAGGGGAAGGGGG + Intronic
1033601890 7:142894344-142894366 CTGGGAGGCTGAGAGGAAGGTGG + Intergenic
1033653808 7:143360879-143360901 CTGCAGGACTCAGGGGAAGGAGG + Intronic
1034711579 7:153196760-153196782 CTTTGTGTCTCAGAGGAGGTTGG - Intergenic
1034978622 7:155461854-155461876 CTGTGGGAATCAGGGGCAGGTGG - Intronic
1035294957 7:157861769-157861791 CTGCGTGGCTCGGAGGCAGGAGG - Intronic
1035422423 7:158740770-158740792 GAGTGTGGCTCAGAGGAGGGCGG + Intronic
1035920165 8:3668000-3668022 CTGTGCGCCTCAGAGCAAGCTGG + Intronic
1036185687 8:6620759-6620781 CTGTTTGACTCAGAGGACCGCGG - Intronic
1036464883 8:8987574-8987596 CTTTGTGAGTCCGAGGCAGGTGG + Intergenic
1036699239 8:11000980-11001002 CCTTCTGAATCAGAGGAAGGGGG - Intronic
1037704330 8:21306023-21306045 ACGTGTGACTCAGAAGATGGTGG - Intergenic
1037803346 8:22046707-22046729 GTGTGTGGCTCAGAGGAGAGAGG - Intronic
1038651582 8:29408600-29408622 CTGTTTGACACTGAGGAAGTTGG + Intergenic
1038747030 8:30263499-30263521 ATGTGTGCCTGAGAGGAAGAGGG - Intergenic
1038764068 8:30411312-30411334 CTGTGGGAGACAGAGGACGGAGG + Intronic
1039129160 8:34242058-34242080 GTGTGTGACTGAGAAGGAGGGGG + Intergenic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1039552605 8:38453956-38453978 CTGTGGGAGGCAGAGGCAGGAGG - Intronic
1041233088 8:55773021-55773043 CTCTTTGACCCAGAGGAGGGAGG + Intronic
1044579823 8:93813610-93813632 CTGTGTGACTAAGTGGGTGGTGG + Intronic
1044680402 8:94772234-94772256 CTGTGTGCTTCTGAGGAAGGGGG - Intronic
1044874137 8:96647600-96647622 CTGTGTGACTTTGAAGAATGTGG + Intronic
1045267994 8:100636962-100636984 CTGTGGGAGGCAGAGGCAGGTGG - Intronic
1045685421 8:104706433-104706455 TTGTCTGTCTCTGAGGAAGGGGG + Intronic
1046228942 8:111327551-111327573 CTGTGTTACTCAAAGGAATAAGG - Intergenic
1046275220 8:111950153-111950175 CCGTGGGAATCAGTGGAAGGAGG + Intergenic
1047204948 8:122795474-122795496 CTATGTGCCACAAAGGAAGGTGG - Intronic
1048116209 8:131526173-131526195 CTGTGGGAATCAGAAGAAAGGGG + Intergenic
1048901555 8:139042716-139042738 CTTTGTGAGGCAGAGGCAGGTGG + Intergenic
1049204961 8:141359374-141359396 CTCTCTGACTCTGAGGAAGAAGG - Intronic
1049513136 8:143039721-143039743 CTGGGGTGCTCAGAGGAAGGGGG + Intronic
1049586209 8:143433525-143433547 GTGTGTGCATCCGAGGAAGGTGG + Intergenic
1049678636 8:143905073-143905095 CTTTGTGAGTCCGAGGTAGGAGG + Intergenic
1050422756 9:5484056-5484078 CCATGTGACTCAGGGGAAGATGG - Intergenic
1051398026 9:16647439-16647461 CTATGTGGCTCAGGGAAAGGAGG + Intronic
1051438439 9:17057173-17057195 CTGTGGGAGGCAGAGGCAGGAGG - Intergenic
1051897677 9:22005842-22005864 GTCTGAGACTCACAGGAAGGAGG - Exonic
1053458948 9:38253532-38253554 CTTTGTGACTCTGAGGCAGGTGG + Intergenic
1053515367 9:38725979-38726001 CAGTGAGACTCAGAGGCAGCTGG - Intergenic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1057230718 9:93319817-93319839 CTGTGGGACTCAGCGCATGGTGG + Intronic
1059050207 9:110916547-110916569 CTTTGTGACTCAGACCCAGGTGG + Intronic
1059264778 9:113016884-113016906 CTTTGGGAGTCAGAGGCAGGAGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1060215041 9:121733805-121733827 GTGTGTGACTGTGAGAAAGGCGG + Intronic
1060652474 9:125340425-125340447 CTGTGTAACTTTGAGGAAGAGGG + Intronic
1060855133 9:126909019-126909041 CTGTGAGACTCTGAAGAAGAGGG - Intergenic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1061539298 9:131268954-131268976 CTTTGGGAGCCAGAGGAAGGTGG + Intronic
1061744182 9:132727733-132727755 GTGTGAGAGTCAGATGAAGGAGG - Intronic
1061860398 9:133465012-133465034 CTGTGTGACATGGAGGAAAGGGG - Intronic
1061970993 9:134045412-134045434 CTGTGTGTTGCAGAGGAAGATGG - Exonic
1062076201 9:134591283-134591305 GTGTGAGAGTCAGATGAAGGAGG - Intergenic
1062205842 9:135336662-135336684 CTGGGTGCCTCAGAGCCAGGAGG - Intergenic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1062706523 9:137947282-137947304 ATCTGTGACACAGTGGAAGGGGG + Intronic
1186454323 X:9699267-9699289 CTGAGTTACACAGAGGAGGGAGG - Intronic
1186773584 X:12841389-12841411 CTTTGGGAGTCAGAGGCAGGAGG + Intergenic
1187514795 X:19959271-19959293 ATGTGTGACTCAGCAGAAGATGG - Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187715175 X:22095542-22095564 CTGTGAGACTCCGAGGGCGGAGG + Intronic
1188245522 X:27832112-27832134 CTCTGTGACCTAGAGGAAAGAGG - Intergenic
1190003143 X:46708670-46708692 CTGAGTGACTTAGAGGCATGTGG - Intronic
1190242149 X:48665748-48665770 CTTTGGGAGTCAGAGGCAGGCGG + Intergenic
1190733585 X:53240599-53240621 CTGGCTGCCTTAGAGGAAGGCGG + Intronic
1191135568 X:57060180-57060202 CTTTGTGACGCTGAGGCAGGTGG - Intergenic
1192748189 X:73960753-73960775 CTTTGGGACACAGAGGCAGGCGG - Intergenic
1193247224 X:79243542-79243564 CTTTGTGAGTCCGAGGCAGGTGG - Intergenic
1194087250 X:89543841-89543863 CTTTGGGAGGCAGAGGAAGGTGG - Intergenic
1195371974 X:104185148-104185170 CTTTGTGAGGCAGAGGCAGGAGG - Intronic
1196311669 X:114174952-114174974 CTTTGGGACGCAGAGGCAGGCGG - Intergenic
1198317447 X:135483262-135483284 CTTTGGGACGCCGAGGAAGGAGG + Intergenic
1199026643 X:142947114-142947136 CTTTGGGAGGCAGAGGAAGGCGG + Intergenic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199844396 X:151680276-151680298 TTGGGTGACTCAGAGGATGGAGG - Intergenic
1199953925 X:152727452-152727474 CTGTGTGTCTCAAAGGTTGGGGG - Intergenic
1200439899 Y:3199714-3199736 CTTTGGGAGGCAGAGGAAGGTGG - Intergenic
1201058678 Y:10021348-10021370 CTTTGGGAGTCTGAGGAAGGTGG + Intergenic
1201780494 Y:17716072-17716094 CTGTGGGAAGCAGAGGCAGGAGG + Intergenic
1201821060 Y:18189918-18189940 CTGTGGGAAGCAGAGGCAGGAGG - Intergenic
1202069822 Y:20979344-20979366 CTGTGGGACCCTGAGGCAGGTGG - Intergenic