ID: 911909967 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:103621228-103621250 |
| Sequence | TCATTTAGAGGCACTCCAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911909967_911909969 | 1 | Left | 911909967 | 1:103621228-103621250 | CCTTCTGGAGTGCCTCTAAATGA | No data | ||
| Right | 911909969 | 1:103621252-103621274 | AATGTGCTGAAACCTCTGAAAGG | 0: 6 1: 0 2: 0 3: 15 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911909967 | Original CRISPR | TCATTTAGAGGCACTCCAGA AGG (reversed) | Intronic | ||