ID: 911909967

View in Genome Browser
Species Human (GRCh38)
Location 1:103621228-103621250
Sequence TCATTTAGAGGCACTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911909967_911909969 1 Left 911909967 1:103621228-103621250 CCTTCTGGAGTGCCTCTAAATGA No data
Right 911909969 1:103621252-103621274 AATGTGCTGAAACCTCTGAAAGG 0: 6
1: 0
2: 0
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911909967 Original CRISPR TCATTTAGAGGCACTCCAGA AGG (reversed) Intronic