ID: 911912728

View in Genome Browser
Species Human (GRCh38)
Location 1:103655304-103655326
Sequence AGGGAGAAACAGAATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 2, 1: 1, 2: 3, 3: 78, 4: 751}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911912721_911912728 15 Left 911912721 1:103655266-103655288 CCAGGGATATGCGACAAGGACTA 0: 3
1: 0
2: 0
3: 3
4: 49
Right 911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG 0: 2
1: 1
2: 3
3: 78
4: 751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911912728 Original CRISPR AGGGAGAAACAGAATATGGA AGG Intronic
900202753 1:1418606-1418628 AGAGAGAAACAGAACACGGCAGG + Exonic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900899201 1:5505374-5505396 AGGGAGGAACAGAATGTTGTTGG + Intergenic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
901897294 1:12325072-12325094 AGGGGGAAAAAAAAGATGGAAGG - Intronic
902219664 1:14957050-14957072 ACGAAGAAACAGAACACGGAAGG - Intronic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
902737295 1:18409533-18409555 AGGAAGAAACAGGATCTGAAGGG - Intergenic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904117544 1:28173813-28173835 AGAGAGAGACAGAATATGCAGGG - Intronic
904170296 1:28587135-28587157 AGAGAGAAACAGAACAGGGTAGG + Intergenic
904505532 1:30949761-30949783 AAGGAGTAAAAAAATATGGAAGG + Intronic
904573150 1:31483099-31483121 AGAGAGAAACAGAACAGGGCAGG + Intergenic
904803705 1:33116460-33116482 GGGGAGAAAAAGGATATGAATGG - Intronic
904806546 1:33136190-33136212 AGGGAGAAAGGGAGAATGGAGGG - Intergenic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
906498911 1:46325777-46325799 AGAGAGAAACAGAACAGGGCAGG + Intergenic
906499659 1:46332298-46332320 AGAGAGAAACAGAACAGGGCAGG + Intergenic
907619560 1:55962655-55962677 AGAGAGAAAGAGAAATTGGAAGG - Intergenic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908581161 1:65519086-65519108 AGAGAGACACAGAGGATGGAAGG - Intronic
908830757 1:68176086-68176108 AGGGACAAAAATAATATGGCTGG + Intronic
910648094 1:89535087-89535109 AAGGGGAAAAAGAATATGGCTGG + Intronic
911253953 1:95612784-95612806 ATGGACTAACAGAATTTGGATGG + Intergenic
911396164 1:97313596-97313618 AATGAGAAACAGAATAGAGAAGG - Intronic
911463603 1:98222399-98222421 AGAGAGAGAGAGAATATGCACGG + Intergenic
911701345 1:100956401-100956423 AGGGAGTAGCAGACTTTGGAAGG + Intronic
911909622 1:103616418-103616440 AGGGAGAAACAGAACAGGGCAGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
912336886 1:108871522-108871544 AGAGTGAAACAGGATAGGGAAGG - Intronic
912617279 1:111115846-111115868 AGGGAAAAACAGTATATAGAGGG - Intergenic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
913695932 1:121325586-121325608 AGGTAGAAAAAGATTATAGAGGG + Intronic
914141632 1:144954473-144954495 AGGTAGAAAAAGATTATAGAGGG - Intronic
914248674 1:145904357-145904379 AGAGAGAAAGGCAATATGGATGG - Intronic
915505708 1:156355002-156355024 TGGGAGAAATGGAATTTGGAAGG + Intronic
915662697 1:157417059-157417081 AGGGATAAAAAGGATGTGGAGGG - Intergenic
916232193 1:162551448-162551470 AGGGAGAGAGGGAATAAGGAAGG - Intergenic
916359381 1:163951508-163951530 AGGGAGAAACCAAAGATGTAAGG + Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916854754 1:168738120-168738142 AGGCACCAGCAGAATATGGAAGG + Intergenic
916893527 1:169137478-169137500 AGGGTGAGGCAGATTATGGAAGG + Intronic
917117311 1:171615653-171615675 AGAGAGAAACAGAACAGGGCAGG - Intergenic
917739067 1:177945808-177945830 AGAGAGATACAGAACAGGGAGGG + Intronic
917760250 1:178148915-178148937 TCGGAGAAAGAGAAGATGGATGG - Intronic
917802530 1:178583323-178583345 AGGGAGAAACAGTATATATAGGG - Intergenic
918372422 1:183874471-183874493 AGGAAGAAAAAGATTATGAAAGG - Intronic
918385229 1:184000344-184000366 AGGGAGAAACATAAAATGAGAGG - Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918632920 1:186740269-186740291 ACTGAGAAAGAGAGTATGGATGG - Intergenic
918638150 1:186804674-186804696 ACTGGGAAACTGAATATGGAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918805908 1:189044212-189044234 ATGTGGAAATAGAATATGGAAGG - Intergenic
919334690 1:196217238-196217260 AGAGAGAAACAGAACAGGGCAGG + Intergenic
919508439 1:198429852-198429874 AGTGAGAAAAAGAATTTTGAAGG - Intergenic
920449962 1:206052750-206052772 AGAGAGAAACAGAACAGGGCAGG - Exonic
920450608 1:206058662-206058684 AGAGAGAAACAGAACAGGGCAGG - Intronic
920483258 1:206343954-206343976 AGGTAGAAAAAGATTATAGAGGG + Intronic
920966124 1:210702317-210702339 AAAGAAAAACAGAAAATGGAGGG - Intronic
921591327 1:217007721-217007743 AGGGAGGAAGAAAAGATGGAAGG - Intronic
922092609 1:222411125-222411147 AAGGGTAAACAGTATATGGATGG + Intergenic
922122150 1:222682030-222682052 ACGGAGAACCAGACTATGAATGG + Intronic
922788060 1:228293282-228293304 TGGAAGATACAGAACATGGATGG - Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923887260 1:238172835-238172857 TGGGAGCAAGAGAATTTGGAAGG - Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
924908854 1:248487312-248487334 AGGAAGAACTAGAATTTGGAGGG - Intergenic
924915253 1:248560750-248560772 AGGAAGAACTAGAATTTGGAGGG + Intergenic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063049429 10:2430813-2430835 AGGAAGAAAGAAAATAAGGAAGG + Intergenic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1063961735 10:11311773-11311795 ACCGAGAAACAGAATATGAGAGG + Intronic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065079799 10:22116996-22117018 AGTGAAAAACAGACTATGAAGGG + Intergenic
1065639799 10:27770269-27770291 AGAGAGAAAGAGAAAATGGAAGG - Intergenic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065674749 10:28162838-28162860 AGTGAGAGAAAGAATATGGAGGG - Intronic
1065694836 10:28370217-28370239 AGGGAGAAAGAGAGGATGGAAGG + Intergenic
1065801993 10:29360663-29360685 AGGGAGGAACAGAACAGGGCAGG + Intergenic
1068099368 10:52532852-52532874 AGAGAGAGATAGAATATAGAGGG - Intergenic
1068201427 10:53788627-53788649 AGGGAGAAAGAGAGAAAGGAAGG + Intergenic
1068351096 10:55846084-55846106 AGGGAGAAAGAGAATTTGAAGGG + Intergenic
1069320102 10:67159143-67159165 AGAGAGAAACAGAACAGGGCAGG - Intronic
1069362701 10:67661269-67661291 AGGAAGAAAGAGAAAAAGGAGGG + Intronic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071010633 10:80936341-80936363 AGAAAGCAAAAGAATATGGAAGG - Intergenic
1071288121 10:84167414-84167436 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1071288625 10:84172215-84172237 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1072688759 10:97555690-97555712 AGAGAGAAACAGAACAGGGCAGG + Intronic
1072832213 10:98670748-98670770 AGAGAGAAACAGAACAGGGCAGG - Intronic
1073552983 10:104420707-104420729 AAAGAGAAAAAGAAAATGGAAGG - Intronic
1073788881 10:106919756-106919778 TGGGAGCAACAGAATATGAGTGG + Intronic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1074490489 10:113935295-113935317 AGAGGGAGACAGAAAATGGAGGG - Intergenic
1074643320 10:115414309-115414331 AGGGAGTAAGAGAAGAGGGAGGG - Intronic
1074746851 10:116543140-116543162 TGGTAGAAACACAAGATGGAAGG - Intergenic
1075301714 10:121330639-121330661 AGGGAGGGAGAGAAAATGGATGG - Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075847263 10:125555017-125555039 AGGAAGACACAGAAGAGGGAAGG - Intergenic
1075904528 10:126069567-126069589 AGGGAGGATCAGAATATGAGTGG + Intronic
1076019070 10:127055565-127055587 AGGGAGAAATAGATAATGGATGG + Intronic
1076488104 10:130837138-130837160 AGGGAGAAACAGAAGCTCCATGG - Intergenic
1077280582 11:1743316-1743338 ATGGACAAACGGAAGATGGATGG + Intronic
1078001838 11:7503032-7503054 AGGCAGAAAGAGAGTTTGGAGGG + Intronic
1078039665 11:7848234-7848256 AGGGAGAGATTGAATGTGGATGG - Intergenic
1079114266 11:17630988-17631010 TGGCAGAACCAGAAGATGGAAGG - Intronic
1079124647 11:17709838-17709860 AGGGATAAGCAGATTTTGGAGGG + Intergenic
1079594269 11:22222849-22222871 GGGAGAAAACAGAATATGGAAGG - Intronic
1079626339 11:22621161-22621183 AGGGAGAAGCAGAGTATTAAGGG + Intergenic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080266476 11:30407065-30407087 AGGGAGAAACGGAAGCTGGGAGG - Intronic
1080381785 11:31779389-31779411 TGGGAGAAACGGAATTAGGAAGG + Intronic
1080494635 11:32804652-32804674 AAGAAGGAAGAGAATATGGAAGG - Intergenic
1080665571 11:34332873-34332895 AGGGAGTCACAGGACATGGAAGG + Intronic
1081647002 11:44797069-44797091 AGGAACATCCAGAATATGGAAGG - Intronic
1082219207 11:49612787-49612809 TGGGAAAAAGAGAAAATGGAGGG - Intergenic
1082677313 11:56121853-56121875 AGGGAAAAAAAGAGTATGGAAGG - Intergenic
1083537310 11:63481467-63481489 AGGGACAAACAGAATTCAGAAGG - Intronic
1084470273 11:69355478-69355500 TGGGAGGCACAGAATAAGGAGGG - Intronic
1085118804 11:73953553-73953575 AGAGAGAAACAGAACAGGGCAGG + Intronic
1085119857 11:73960152-73960174 AGAAAGAAAAAGAAAATGGAGGG - Intronic
1085240440 11:75049619-75049641 AGGGAGGAACAGAACAGGGCAGG + Intergenic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1085910437 11:80818535-80818557 AGAGAGAGAGAGATTATGGAAGG + Intergenic
1086824682 11:91481924-91481946 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1088226531 11:107626489-107626511 AGGAAGGAAGAGAATAAGGAAGG - Intronic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1089057049 11:115594204-115594226 AGTGAGAAAAAAAAAATGGAGGG + Intergenic
1089209272 11:116789634-116789656 AGGGAGAAAGAGAATATCATGGG - Exonic
1089710415 11:120310575-120310597 AGGGAGAAATGGTATCTGGAGGG + Intronic
1090508445 11:127345207-127345229 AATGAAAAACAGAGTATGGATGG - Intergenic
1090833845 11:130439398-130439420 AGGGAGAAAAAGGAGAGGGAGGG + Intergenic
1090937401 11:131355951-131355973 AGGAAGAAACAGAATATGAAAGG - Intergenic
1091035261 11:132227438-132227460 AAAGGGAAGCAGAATATGGAGGG + Intronic
1091114740 11:133002714-133002736 AGGGAGAAAGAGAGGAGGGAAGG + Intronic
1091517390 12:1198377-1198399 AGAGAGATACAGAATACAGAGGG + Intronic
1092570205 12:9713159-9713181 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1092729353 12:11513854-11513876 AGAGAAAAACAGAAAATGAAGGG + Intergenic
1092798516 12:12139108-12139130 AGGGAGAAACTGAATAAAGCAGG - Intronic
1093165502 12:15801187-15801209 AGGCAGGGGCAGAATATGGAAGG - Intronic
1093374884 12:18412924-18412946 AGGGTAAAACACAAAATGGAGGG - Intronic
1093504561 12:19850178-19850200 TGGGAGAAAAAGAATTTGGTAGG + Intergenic
1093748970 12:22776999-22777021 AAAGAGAGACAGAATATTGAAGG - Intergenic
1094535602 12:31319999-31320021 AGGAAGAAACAGAATTTCTAAGG - Intronic
1095475285 12:42580937-42580959 AGGGAGAGAGAGAGTAAGGAAGG + Intronic
1095797932 12:46240924-46240946 AGGGAGAAAAAGAATTTTGGGGG + Intronic
1095881978 12:47147499-47147521 CAGTAGAAATAGAATATGGATGG - Intronic
1096286031 12:50301127-50301149 AGGGAGAAAAAGAAAATGAAAGG + Intergenic
1097836072 12:64273923-64273945 AGGCAGAGACAGAATATGAGTGG + Intronic
1098083260 12:66812549-66812571 GGTGTGAAACAGAATATGGAGGG + Intergenic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1099961575 12:89402132-89402154 AGGGAGAAACAAAAAAGAGAAGG - Intergenic
1100106963 12:91187111-91187133 AGGGATGAAAAGAATATGCATGG + Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100744824 12:97634203-97634225 ATGGCAAAAAAGAATATGGAAGG + Intergenic
1100908588 12:99332056-99332078 AGGGAGGAACAAACTGTGGAAGG - Intronic
1101329353 12:103744949-103744971 AGGGAAAAACATAATAGAGAAGG - Intronic
1101547386 12:105728831-105728853 AGGAAGAAACAGAGTATGAGAGG + Intergenic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101783366 12:107858864-107858886 AGTGAGAAACAGAAAAGGAAAGG + Intergenic
1102074619 12:110049860-110049882 AGAGAGAAACAGAACAGGGCAGG - Intronic
1102538814 12:113603124-113603146 AGGAAGAAAGACAAGATGGAGGG - Intergenic
1103151859 12:118647787-118647809 AAGGAGAAAAGAAATATGGAAGG + Intergenic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104136328 12:125942840-125942862 AGGGATAAACAGAACATGAAGGG - Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1104360486 12:128128460-128128482 ATCAAGAAACAGAAAATGGATGG - Intergenic
1104497188 12:129251898-129251920 AGGCAGAAACACAAGGTGGAAGG + Intronic
1105003763 12:132708372-132708394 GGGGAGAAACGAAATGTGGAAGG + Intergenic
1106973328 13:35173164-35173186 AGAGGGTAACAGAATAAGGAAGG + Intronic
1107409864 13:40148584-40148606 AGGAAGGAAGAGAATCTGGAAGG - Intergenic
1107905372 13:45056636-45056658 AGGGAGAAACAGAAAAAAGGAGG - Intergenic
1107978274 13:45710919-45710941 AGAGAGAAACACAATTTGCATGG - Intronic
1107997055 13:45871353-45871375 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1108044036 13:46366133-46366155 AGGGAGAAAATGAATGTGGGTGG - Intronic
1108166986 13:47703462-47703484 AGGTAAAAAAAGAATATAGAGGG - Intergenic
1108253796 13:48591666-48591688 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1108424151 13:50281173-50281195 AGGAAGGATAAGAATATGGATGG - Intronic
1108552140 13:51557132-51557154 AGGCAGAACCATAATACGGAAGG + Intergenic
1108724877 13:53169531-53169553 AGAGAGAGAGAGAATATGTATGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109668667 13:65574011-65574033 AAGGAAAAAGAGTATATGGAAGG + Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1109910795 13:68907491-68907513 AAAGAGAAACAGACTATAGAGGG - Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110624936 13:77643791-77643813 TGGGGGAAGCAGAATATAGAAGG - Intronic
1111679185 13:91423459-91423481 TGGGAGATACAGACTTTGGAAGG + Intronic
1111780387 13:92716238-92716260 AGGAAGTAGCAGAAAATGGAGGG - Intronic
1111932422 13:94525507-94525529 AGGGAAAGACAGAATAAAGATGG - Intergenic
1112150706 13:96759344-96759366 AAGGAGAAACAGAAAACTGATGG - Intronic
1112166608 13:96926848-96926870 AAGAAGAAACAGAACATAGATGG + Intergenic
1112669550 13:101618850-101618872 AGGGAGAAAAAAAATATTCAGGG + Intronic
1112792651 13:103019743-103019765 AAGGAGTAACAGAAAAGGGACGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113247918 13:108419713-108419735 AGGGAGAAACACCATAAGGTAGG + Intergenic
1113479979 13:110613769-110613791 GGGCAGAAACAGAACATGGGAGG + Intergenic
1114042709 14:18693516-18693538 AGGGACAAATGGGATATGGAGGG - Intergenic
1114378507 14:22175261-22175283 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1114529399 14:23386409-23386431 AGGGTGAAGAAGAAGATGGAAGG - Exonic
1114534800 14:23416098-23416120 AGGGTGAAGAAGAAGATGGAAGG - Exonic
1115026502 14:28753176-28753198 AGGAAGATAGAGAAGATGGAGGG + Intergenic
1115659084 14:35473874-35473896 AGGAAGAAAATGAATTTGGAAGG + Intergenic
1116057051 14:39876691-39876713 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116360493 14:43989754-43989776 AGGTATAAAATGAATATGGATGG + Intergenic
1116440186 14:44942155-44942177 AGAGAGAGAGAGAATATGGGAGG - Intronic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1118035081 14:61857838-61857860 GGGAAGAAAGAGTATATGGAAGG + Intergenic
1118136451 14:63033343-63033365 AAGGAGAAAAAGAAAATGAATGG - Intronic
1118248084 14:64131271-64131293 AGGGATTCACATAATATGGAGGG + Intronic
1118757325 14:68854288-68854310 AGGGAGAGACTGAACATGCAGGG - Intergenic
1118838514 14:69493942-69493964 AGGGGGAAGCAGCATATGCAGGG + Intronic
1118873553 14:69763993-69764015 AGGTATAAACAGAATATTGTAGG + Intronic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1119032053 14:71200454-71200476 AGGGTGAGACAGAGTAGGGACGG - Intergenic
1119838204 14:77770205-77770227 AAGGACAAACAGAATATGTATGG - Intergenic
1120020950 14:79529264-79529286 AGAGAGAAACAGAACAGGGCAGG + Intronic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1121349938 14:93165343-93165365 AGAGAGAAACAGAACACGGCAGG - Intergenic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121701430 14:95957302-95957324 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1121735012 14:96212079-96212101 AGGCAGGGACAGAATCTGGAGGG + Intronic
1123133828 14:106009876-106009898 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1123583852 15:21740297-21740319 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1123620502 15:22182900-22182922 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1124052487 15:26210631-26210653 AGTGTGCATCAGAATATGGAAGG + Intergenic
1124362873 15:29051716-29051738 GGGGGGATACACAATATGGAAGG + Intronic
1124436893 15:29657523-29657545 GGACAGAAACAGAATATGGGTGG - Intergenic
1125345095 15:38711230-38711252 AAGGAAACACAGAATTTGGATGG + Intergenic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1127943582 15:63726635-63726657 AAGAAGAAACATAAGATGGAAGG + Intronic
1128142722 15:65313568-65313590 AAGGAGAAAGAGAAGATGAAGGG - Intergenic
1129167254 15:73785690-73785712 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1129844840 15:78763519-78763541 AGGGAGAAACAGACAAGGAAAGG - Intronic
1129982911 15:79890543-79890565 AGGGAGGAACAGAAAAGGAAGGG - Intronic
1130256982 15:82330334-82330356 AGGGAGAAACAGACAAGGAAAGG + Intergenic
1130304829 15:82706344-82706366 ATGGAGGTACAGGATATGGAAGG - Intronic
1130597966 15:85259654-85259676 AGGGAGAAACAGACAAGGAAAGG - Intergenic
1131893262 15:96997504-96997526 AGGCAGAGACAGAAAAGGGAAGG - Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134395943 16:13863430-13863452 AGAGAGGAACAGAAGATAGAAGG + Intergenic
1135618622 16:23933814-23933836 ATCGACAAACAGAAGATGGATGG - Intronic
1135667976 16:24351808-24351830 AGAGAGAGAGAGAAGATGGAAGG - Intronic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1135825908 16:25728740-25728762 ACTGAGAAACAGAAGATGTAAGG - Intronic
1136350997 16:29707718-29707740 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137906926 16:52332670-52332692 AGGGACAAATGGAAGATGGAGGG - Intergenic
1137922250 16:52501933-52501955 AGGCAGCAACAGAATAGAGAAGG + Intronic
1138467752 16:57204941-57204963 AGAAAGAAACAAAATGTGGATGG + Exonic
1138535672 16:57659050-57659072 GGGAAGACACAGAATGTGGATGG + Intronic
1138769049 16:59640404-59640426 AGCCAAAAAAAGAATATGGAAGG - Intergenic
1139270385 16:65676976-65676998 AGGGAAGAACAGAAGTTGGAAGG + Intergenic
1139289189 16:65841649-65841671 AGTGAGAAACAGAAAATGAGAGG - Intergenic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139577511 16:67851185-67851207 AGAGAGACACAGAATAGGCAGGG + Intronic
1141263445 16:82474512-82474534 CTGGAGAAACAAAATCTGGAAGG + Intergenic
1141373412 16:83508042-83508064 AGAGAGAAAGAGAAGAAGGAAGG + Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1141854824 16:86673828-86673850 AGGGAGGAATGGAAAATGGATGG - Intergenic
1141862528 16:86727729-86727751 AAGGAGAAAGAAAATATGGTCGG + Intergenic
1142489156 17:266711-266733 AGTGAGAAACAGAATTCTGAGGG + Intronic
1143478015 17:7214036-7214058 ACAGAGAAACGGAAAATGGAGGG - Intronic
1143715705 17:8767205-8767227 AAGGAGAAAAAGAAAATGGATGG - Intergenic
1144028313 17:11297867-11297889 AGGAGGAAAGAGAAAATGGATGG + Intronic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1145120055 17:20250924-20250946 AGGTATAAAAAGAATATGGTTGG + Intronic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147488289 17:40840185-40840207 AGGTGGAAAGAGGATATGGAAGG - Intergenic
1147669421 17:42168181-42168203 AGGGAGACCCAGAGTATTGAGGG - Intronic
1148050827 17:44769291-44769313 AGGGACAAACAGGAAATGGGAGG - Intronic
1148783890 17:50135859-50135881 AGGGAGGCACAGAAGTTGGAGGG - Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150771996 17:68050193-68050215 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150772007 17:68050257-68050279 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151000078 17:70365475-70365497 TGGGAGAAAAAGAAGATGAAAGG - Intergenic
1152050907 17:77976162-77976184 AGTGAGAAACAGACTACGCAGGG - Intergenic
1153319534 18:3759043-3759065 AGGAAGAACAAGAATATAGAAGG - Intronic
1155364189 18:25033880-25033902 AGAGAGAACCACAACATGGAGGG + Intergenic
1155495528 18:26438349-26438371 AGGGTGGAACAAAGTATGGAAGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156581293 18:38379544-38379566 AGGGAGAGACAGACTATAAATGG + Intergenic
1156860060 18:41825661-41825683 GGAGAGAAACATAATACGGATGG + Intergenic
1157046002 18:44102698-44102720 AGAGAGTAGCAGCATATGGAAGG + Intergenic
1157177513 18:45465035-45465057 AGACAGAAACAGACAATGGAAGG + Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1158914939 18:62115032-62115054 AGGGATAAAAAGAACATTGATGG - Intronic
1159049414 18:63405513-63405535 AGGATGAAATAGAATATGAAAGG - Intronic
1159125035 18:64213337-64213359 AGGGTGAAACAGAGTATAAATGG + Intergenic
1159315836 18:66772184-66772206 GCGGAGAAACAGACTATGAATGG + Intergenic
1159671875 18:71230766-71230788 AGACAGACACAGAATATGGATGG - Intergenic
1159689813 18:71472484-71472506 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1159725072 18:71947059-71947081 AGGAAGGAATAGAAGATGGAGGG - Intergenic
1159953241 18:74500895-74500917 AGAGAGAAACAGAACAGGGCAGG + Intronic
1160313337 18:77818528-77818550 AGGAAGAAAGGGAAGATGGAGGG - Intergenic
1160839753 19:1140805-1140827 TGAGAGAAACAGGAAATGGATGG + Intronic
1161446030 19:4319684-4319706 AGGGAGAAGCAGAAGATATAGGG + Intronic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163907722 19:20161660-20161682 AGGGAGGAACAGAACAGGGCAGG - Intergenic
1163934165 19:20426352-20426374 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1163934708 19:20432349-20432371 AGGGAGGAACAGAACAGGGCGGG + Intergenic
1164234509 19:23320526-23320548 AGGGAGAAAGTGAATAAAGAAGG + Intronic
1164571342 19:29376827-29376849 AGGCAGAAACAGAAAAGAGATGG + Intergenic
1164702084 19:30292734-30292756 AGGGAGAGAATGAAGATGGAAGG + Intronic
1164835481 19:31352600-31352622 AGGGAGAAATAGTGTCTGGATGG + Intergenic
1164937098 19:32223457-32223479 AGGAAGAAAGAGAGGATGGAAGG + Intergenic
1165523609 19:36333262-36333284 AGGAGGAAATAAAATATGGATGG + Intergenic
1165592085 19:36977714-36977736 AGGGAGAAATAGACAATGAAGGG - Intronic
1165912358 19:39237130-39237152 AGGGAGAAGGAGAAGATGAAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166787183 19:45375071-45375093 AGGGAGAAAGAGAGAAAGGATGG + Intergenic
1167180409 19:47898871-47898893 TGGGGCAAACAGAATATGTATGG + Intergenic
1167604299 19:50473288-50473310 AGGGAGAAATAGAGGAAGGAGGG - Intronic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167938131 19:52923855-52923877 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1168425213 19:56234669-56234691 AGAGAGAAACAGAACAGGGCAGG - Intronic
1168607060 19:57768635-57768657 AGGGAGGAACAGAACAGGGCAGG + Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925684079 2:6453285-6453307 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
925881709 2:8358120-8358142 AGGGAGAGACAGGAGATGGAGGG + Intergenic
925892085 2:8442625-8442647 AGAGAGAAAGAAAATATGAAAGG + Intergenic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
927075824 2:19576281-19576303 AGGAAGAATCAGAAGATGTAAGG - Intergenic
927124033 2:19996940-19996962 AGACAGAAACAGATCATGGAGGG + Intronic
928768558 2:34677412-34677434 AGAGAGAAACAGAACAGGGCAGG - Intergenic
929042815 2:37762001-37762023 AGAGGGAAACAGAATATTGCAGG + Intergenic
929175868 2:38975463-38975485 AGTGATAAACAGAAGATGAAAGG - Intergenic
929307303 2:40378207-40378229 AGGGGGAAACAGTATATGGAAGG + Intronic
929352373 2:40973120-40973142 AGGGAGAAAAAATATATAGAAGG + Intergenic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929419728 2:41778443-41778465 GGGAAGAAATAGAATAGGGAGGG - Intergenic
929932985 2:46273055-46273077 AGAAAAAAACAGAATTTGGATGG + Intergenic
930451010 2:51538346-51538368 AGTGATAAACAGAATATGACAGG + Intergenic
930472269 2:51832891-51832913 AGAGAGAAAGAGAAAATAGAGGG - Intergenic
930953797 2:57178336-57178358 AGGAAGAGACAGAAGATAGAGGG - Intergenic
931195351 2:60047508-60047530 AGGGAGATACAGAGTGTGGCTGG + Intergenic
931471489 2:62542486-62542508 AGGAAAAAACAAAATATTGAAGG + Intergenic
931486718 2:62701079-62701101 AGGGAAAGACAGAACTTGGAGGG - Intronic
931730327 2:65147501-65147523 AGGGAGGAAAAAAATAAGGAAGG + Intergenic
932075733 2:68660679-68660701 AGGAAAAAAAAGAATATGAAGGG + Intergenic
932178533 2:69624043-69624065 AGGGAGAAAAAGAAAAGAGAAGG + Intronic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933059999 2:77725242-77725264 AGGGAAAAAAGGAAGATGGAAGG + Intergenic
933332967 2:80918387-80918409 AAAGACAAACAGAATCTGGATGG - Intergenic
933836695 2:86251602-86251624 TGGGAGAAACAGAAGAGGGCAGG - Intronic
934090104 2:88543740-88543762 AGGAATTAACAGCATATGGATGG + Intergenic
934498974 2:94838529-94838551 AGCAAGAGACAGAATTTGGAAGG + Intergenic
934711319 2:96516167-96516189 AGTGAGAAACTGGACATGGACGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935672007 2:105563860-105563882 AGAGAGATATAGAATGTGGAGGG - Intergenic
937564564 2:123268397-123268419 AGGTAGAAATAGCATCTGGAAGG + Intergenic
937859255 2:126695343-126695365 AGGAAGAAAAAGAAAAGGGAGGG + Intronic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
939327325 2:140710663-140710685 AGAGAGAACCAGAAAATGCAGGG + Intronic
940578456 2:155546182-155546204 AGGGAGAGACAGAACAAGGGAGG + Intergenic
940684732 2:156832842-156832864 AAGGAAAATCAGTATATGGAAGG + Intergenic
941173219 2:162164783-162164805 AGACAGAAACAGAATAAGCATGG + Intergenic
941467079 2:165840628-165840650 AAGGAGAAAGACAAGATGGAAGG + Intergenic
941677132 2:168355855-168355877 AAGAAGAAAAAGAATTTGGAAGG - Intergenic
941907292 2:170729183-170729205 AGGAAGAAAGAAAATATGAATGG - Intergenic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942568808 2:177292824-177292846 GAGGAGAAACATAAAATGGATGG - Intronic
942665317 2:178311124-178311146 AGGCAGAACCAGATTATGAATGG - Intronic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943714316 2:191133696-191133718 AGGGAGAAAGACAAAAAGGAAGG + Intronic
943936964 2:193931647-193931669 AGGGAGAAAAGGAAAAAGGAAGG + Intergenic
944692471 2:202170321-202170343 AGTGAGAAACAGAGATTGGAAGG - Intronic
945688791 2:213007160-213007182 AGGAAGAAACAGAAGAGAGAAGG - Exonic
945771656 2:214050747-214050769 AGGGAGAAAAAGAAGATGGGAGG - Intronic
945793964 2:214338578-214338600 AGAGAGAAACAAAAGATAGAAGG - Intronic
946076920 2:217081953-217081975 TGGGAGCAACAGGAGATGGAAGG - Intergenic
946169493 2:217886176-217886198 AGGGAGAAAGAGAGAAAGGAAGG + Intronic
946606553 2:221411485-221411507 AGGGAGGAAGAGAAAAGGGAAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947561029 2:231152252-231152274 AGGCAGCAACAGAATATAGTGGG - Intronic
947940447 2:234049873-234049895 AAGGAGAACCAAAATATAGAGGG - Intergenic
1168953509 20:1818468-1818490 AAGGAGAGACAGAATATTGTGGG - Intergenic
1169565214 20:6846658-6846680 AGGGAGAAAAAGCATATGGTTGG + Intergenic
1169668559 20:8068303-8068325 AGGCAGAAAGAGAGTAGGGAAGG + Intergenic
1169744969 20:8934482-8934504 AGGCAGAAACACAAAATGGAAGG + Intronic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1170017377 20:11797186-11797208 AGAGAGTAAGGGAATATGGAGGG + Intergenic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1170700084 20:18695651-18695673 AGGAAGAAACAGAAAAAGGGAGG - Intronic
1170851368 20:20007575-20007597 AGTGAGAAAGATAAAATGGACGG - Intergenic
1170981059 20:21213295-21213317 AGGGAGAGTCAGAGCATGGAAGG - Intronic
1171304930 20:24097041-24097063 AGGGAGAAACAGATAATGCCTGG - Intergenic
1171378525 20:24714049-24714071 AAAAAGATACAGAATATGGATGG - Intergenic
1171771473 20:29325866-29325888 AGCGAGAAACAGAGAAAGGAAGG + Intergenic
1172171687 20:32939251-32939273 AGAGAGAGAGAGAATATGGAAGG - Intronic
1172561145 20:35889693-35889715 ATTAAGAAACAGAATATGCATGG - Intronic
1174551336 20:51364122-51364144 AGGAAGAAACAGTAAAAGGAAGG + Intergenic
1174737286 20:52976527-52976549 AGGGAGATAGAGAAAATGGCAGG + Intronic
1174827745 20:53783855-53783877 AGAAAGAAAAAGAATGTGGAGGG + Intergenic
1174945791 20:54983883-54983905 AGAGAGAAACAGAACACGGCAGG + Intergenic
1175052190 20:56166138-56166160 AGACAGAAACAGGATAAGGAAGG + Intergenic
1175620123 20:60436746-60436768 AAGGAGAAACAAAATCTGAATGG - Intergenic
1176021968 20:62966667-62966689 AGAGCGAGAGAGAATATGGATGG - Intronic
1176690785 21:9905655-9905677 TAGAAGAAACAGAATATTGAAGG + Intergenic
1176704552 21:10102550-10102572 AGGAAGAAACATAATATGAAAGG + Intergenic
1177134755 21:17297103-17297125 GGATAGAAACAGAACATGGAAGG + Intergenic
1177170329 21:17648099-17648121 AGGGCTAATCAGAATATGAAAGG - Intergenic
1177375953 21:20271118-20271140 AGGGAGGAACAGAACAGGGCAGG - Intergenic
1177535671 21:22423788-22423810 AGGGAGAGAAAGAACATGGAAGG + Intergenic
1177701003 21:24639143-24639165 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1178174413 21:30079635-30079657 AGGGAGGAACTGCAAATGGAGGG + Intergenic
1178256263 21:31055190-31055212 AGAGACAAACAGAAAAAGGAAGG + Intergenic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178735607 21:35147199-35147221 AGGGAGAAAGATATTAAGGATGG - Intronic
1178741026 21:35201458-35201480 ATTGTGAAACAGAATATGCAAGG - Intronic
1178870251 21:36367764-36367786 AGAAAGAAACAGATTATGTACGG + Intronic
1179071212 21:38072789-38072811 AGGGAGAAATGGACTATGGAGGG + Intronic
1179952749 21:44719944-44719966 GGGGAAAAACAGAATATCTAAGG - Intergenic
1181618518 22:24071554-24071576 AGGGAGAAACAAAGGCTGGAGGG - Intronic
1181647387 22:24240287-24240309 AAGAAGAAACAGAATAGGCATGG + Intronic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1182353373 22:29711116-29711138 AGGAAGCAACAGCAGATGGACGG - Intergenic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1184934718 22:47712894-47712916 ATGGAGAGACAGAAAATGCAAGG - Intergenic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949295321 3:2514917-2514939 AGGGGGTAGCAGAAGATGGAGGG - Intronic
949915588 3:8961333-8961355 AGGGAGAAGTAGAAAATGGGTGG + Intronic
949916108 3:8965850-8965872 AGGAAGAAAAAAAATAAGGAAGG - Intergenic
950058532 3:10049326-10049348 AGTGTAAAACAAAATATGGATGG - Intronic
950300294 3:11871249-11871271 AGTGTAAAACAAAATATGGATGG - Intergenic
950472640 3:13196088-13196110 AGAGAGAAAGAGAAGAGGGAGGG - Intergenic
952043367 3:29286642-29286664 AGGGAGGGACACAATATAGAAGG + Intronic
952108503 3:30095971-30095993 AGGGAGAAACAGAGGAAGGGAGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952734459 3:36674988-36675010 AGAGAGAAACAGAACAGGGCAGG - Intergenic
953008892 3:39005087-39005109 AGAGAGAAACAGAACAGGGCAGG + Intergenic
953120547 3:40037044-40037066 AGGAAGAAACAGAAAAGGCATGG + Intronic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
954543095 3:51409116-51409138 AGGGAGAAAGAGATTAGGAAGGG - Intronic
955007952 3:54987307-54987329 AGGCAGAAACAGACTATGAGAGG - Intronic
955216336 3:56987512-56987534 AAAGAGAAACAGAAGATGAAAGG + Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
956045096 3:65187646-65187668 AGGGAGAAACACAATGTCCATGG - Intergenic
956318572 3:67968673-67968695 AGTGAGAAAATGGATATGGATGG + Intergenic
956996402 3:74831066-74831088 AGAGAGAAACAGAACAGGAAAGG - Intergenic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958438337 3:94125183-94125205 AGGAAGAAACAGAAAATTCAGGG - Intronic
958487165 3:94727559-94727581 AAGAAGAAACAGGACATGGATGG - Intergenic
958532883 3:95357060-95357082 AGAGAGAAACAGAACAGGGCAGG - Intergenic
958790142 3:98642956-98642978 AGAGAGAAACAGAACAGGGCAGG + Intergenic
959711865 3:109393666-109393688 AGAGAGAAACAGAACAGGGCAGG - Intergenic
959793260 3:110390602-110390624 AAGAAGAAACAGATTATGAAGGG - Intergenic
959852035 3:111098796-111098818 GAGGAGAAACAGAATATTGCAGG - Intronic
959970795 3:112407333-112407355 AGAGAGAAACAGAACAGGGCAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960176365 3:114522391-114522413 ATGGGGAAATTGAATATGGAGGG + Intronic
960456625 3:117880469-117880491 AGGGAGAAAGGGCATAAGGAAGG - Intergenic
960641517 3:119828650-119828672 AGGGAGACACAGAATATCCAAGG + Intronic
960645328 3:119874287-119874309 AGAGAAAAACAGTATATGTAGGG - Intronic
960700763 3:120437149-120437171 ACAGAGAAAAAGAAAATGGACGG - Intronic
961260394 3:125596963-125596985 AGAGAGAAACAGAACAGGGCAGG - Intergenic
962424767 3:135260025-135260047 AGGGAGAAAAATAAAATGAAAGG + Exonic
962769325 3:138597642-138597664 AGAGAGAAACAGAACAGGGCAGG + Intergenic
963290821 3:143485382-143485404 AAGGAGAAAAAGAAAATCGAAGG - Intronic
963768218 3:149361088-149361110 ACAGAGAAAAAGAATAAGGAGGG - Intergenic
963840677 3:150102695-150102717 AGGAAGGAAAAGAATAAGGAAGG - Intergenic
964271734 3:154964008-154964030 AGGGAGAGAAAGAAGATGGAGGG - Intergenic
965395660 3:168158047-168158069 AGAGAGAAAAAGGAAATGGAGGG - Intergenic
965688968 3:171334793-171334815 AGGGAAAAGCAGAGTATGAAAGG + Intronic
965853615 3:173061808-173061830 TGGGAGCGACAGAATATGTAGGG + Intronic
965973992 3:174598354-174598376 AGGGAGAAAATGAATATAAAAGG - Intronic
966161668 3:176975262-176975284 AGGGGGAAAGAGAGAATGGAGGG - Intergenic
967155975 3:186692620-186692642 AGGATGAAGCAAAATATGGATGG + Intergenic
967391607 3:188961708-188961730 AGGAGGAAACAGAACAAGGAAGG - Intronic
967391630 3:188961819-188961841 AGGGAGAAAAAAGAAATGGAAGG - Intronic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967659709 3:192091642-192091664 AGAGAGAAACAGAACAGGGCAGG + Intergenic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
969321827 4:6417219-6417241 AGGGAGTAAGAGAAAAGGGAAGG + Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970147705 4:13054182-13054204 ATAGAGAAACAAAATCTGGAGGG - Intergenic
970228545 4:13884942-13884964 ATGGAAAAATAGAATATGGCTGG - Intergenic
970228826 4:13887919-13887941 AGGGAGAAGGAGGAAATGGATGG - Intergenic
970385512 4:15552498-15552520 AAGGAGAAACAAATTAGGGAAGG - Intronic
970638677 4:18038752-18038774 AGGGAGAAATGGGAAATGGAAGG - Intergenic
970997132 4:22280460-22280482 AGGGCGAAAGAGAACATGGAGGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971782673 4:31056699-31056721 AGAGAGAAAGAGAAAAAGGAAGG + Intronic
972515470 4:39807078-39807100 AGAGAGAAAAAGAAAAAGGAAGG + Intergenic
972978090 4:44662171-44662193 AGGAAGAAACAGTATATATAGGG - Intronic
973104396 4:46315825-46315847 AGGGATAAACAGAAGAGGAAGGG - Intronic
973291167 4:48472198-48472220 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
974317609 4:60302858-60302880 AGGTGGAAAGAGAATAAGGAAGG + Intergenic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
974757642 4:66232051-66232073 ACAGAAAAAAAGAATATGGATGG - Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
974949444 4:68570302-68570324 AGAGAGAAACAGAACAGGGCAGG + Intronic
974950035 4:68576444-68576466 AGAGAGAAACAGAACAGGGCAGG + Intronic
974987764 4:69051089-69051111 AGAGAGAAACAGAACAGGGCAGG - Intronic
974988342 4:69057088-69057110 AGAGAGAAACAGAACAGGGCAGG - Intronic
975074245 4:70185122-70185144 AGGGAGAAAAATAATTTGGGTGG + Intergenic
976914164 4:90349554-90349576 AGGAAGAAACAGTATATACAAGG - Intronic
976989912 4:91353344-91353366 AGAGAGAAACAGAACAGGGCAGG + Intronic
977135697 4:93300890-93300912 AGAGAGAAACAGAACAGGGCAGG + Intronic
978627921 4:110708486-110708508 AGGAAGAAACAGAAAAAGGCTGG - Intergenic
978833017 4:113112422-113112444 AGGGGGAGACAGAATGTGTATGG + Intronic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
980376759 4:131958883-131958905 AGGAAGAAACATAATATGAAAGG + Intergenic
980725763 4:136758330-136758352 AGGGAGAAACAGGTTAGAGAGGG + Intergenic
980727755 4:136787166-136787188 AGGGAGGAACAGTTTTTGGAGGG + Intergenic
980944151 4:139302280-139302302 AGGGAGGGACAGATGATGGAGGG - Intronic
981014264 4:139957142-139957164 AGGAAGAAACAGAAAACGGAAGG + Intronic
981046109 4:140266821-140266843 AGGGAGAAAGAGAAAAAGTAAGG + Intronic
981409782 4:144416215-144416237 AGAGAAAAACAGAATAAAGAAGG + Intergenic
982121472 4:152147510-152147532 AGGGAGTGAAAGAATAGGGAGGG + Intergenic
982205958 4:152997271-152997293 AGGAAGAGAGAGAATATAGAGGG + Intergenic
982473304 4:155820313-155820335 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
982975108 4:162046825-162046847 AGGGATAAACATATTATAGAAGG - Intronic
983019785 4:162661288-162661310 AGTGACATACAGAAAATGGAAGG + Intergenic
983164901 4:164463331-164463353 AAGGAGGAACAGAAAATGAATGG - Intergenic
983449918 4:167896285-167896307 AGAGAGAAACAGAACAGGGCAGG + Intergenic
983537239 4:168871005-168871027 AGGAAGATACTGAAAATGGAGGG + Intronic
984751124 4:183276376-183276398 AGGAAGAAAAAGAATAAAGATGG - Intronic
985004566 4:185521316-185521338 AGTGAGCAAAAGAAAATGGATGG - Intronic
985052023 4:186000544-186000566 ATGGAGGAAAAGAAGATGGAAGG - Intergenic
985326840 4:188780391-188780413 TGCGAGAAACACACTATGGACGG + Intergenic
985380193 4:189386078-189386100 AGAAAGAAACTGACTATGGAGGG - Intergenic
985936021 5:3099096-3099118 AGTGAGAAAAAGAAGAGGGAGGG - Intergenic
986015193 5:3751522-3751544 AGGGAGAAAGAAAGGATGGAGGG + Intergenic
986519813 5:8602702-8602724 AGGGACACACAGAATGTGCAAGG + Intergenic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
986979170 5:13427231-13427253 AGGGAGAAATATATTATTGAAGG - Intergenic
987446636 5:18027828-18027850 AAGGATAAACAGAATATGTGAGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987808596 5:22803558-22803580 AGGAAGAAGCAAAATATGGGAGG - Intronic
987855886 5:23420312-23420334 AGAGAGAAACAGAACAGGGCAGG + Intergenic
988287576 5:29240108-29240130 AGAGAGAAACAGAACAGGGCAGG + Intergenic
989557374 5:42813399-42813421 AGAGAGAAACAGAACAGGGCAGG - Intronic
989981922 5:50655684-50655706 AGAGAGAAAAAGAAGAAGGAAGG - Intergenic
990252101 5:53926495-53926517 AGGGACAGACAGAATTTTGAGGG - Intronic
990560823 5:56981207-56981229 CGGGAGGAAAAGAATATGGGAGG + Intergenic
990633547 5:57697171-57697193 AGGGAGAAAATGAATCTGAAAGG + Intergenic
991032326 5:62095617-62095639 AGGGAGAAACAGAGAAGGGAAGG + Intergenic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992027443 5:72684609-72684631 AGTGAGAAACAAAAGATGGAAGG - Intergenic
992308920 5:75474157-75474179 AGAGAGAAACAGAACAGGGCAGG - Intronic
992342361 5:75837854-75837876 ATGGATAAACAAAATATGGTAGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993812628 5:92501249-92501271 AGGCAGAAACAGCTAATGGAAGG + Intergenic
993888074 5:93440137-93440159 AGGGAGAGAGAGAATGTGGGTGG - Intergenic
994055789 5:95413477-95413499 AGGGAGAGACATCATATGCAAGG + Intronic
994056169 5:95418629-95418651 AGGGAGAAACAATATATATAGGG + Intronic
994864862 5:105255009-105255031 AGAGAGAAACAGAGGATGGAAGG + Intergenic
995403878 5:111771821-111771843 AGGGAAATACTGAATATTGATGG - Intronic
996128726 5:119755124-119755146 AGAGAGAAACAGAACAGGGCAGG - Intergenic
997750688 5:136342502-136342524 AGGGAGAGACAGATGATGGCTGG - Intronic
998115123 5:139531318-139531340 AGAGAGAAACAGAACAGGGCAGG - Intronic
998231110 5:140361980-140362002 AAGGAGACACAGAATATGAAAGG - Intronic
998333172 5:141347118-141347140 AGAGAGAAACAGAGGAAGGAAGG - Intronic
998499727 5:142621784-142621806 GGGGGGAATCAGAAAATGGAAGG - Intronic
998939349 5:147263764-147263786 AGAGAGAAAGAGAAAATGGAAGG + Intronic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
1000605117 5:163319272-163319294 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1001203476 5:169740716-169740738 CATGAGAAACAGAATATGTAAGG - Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001349877 5:170950336-170950358 AGGGAGGAATAGAATATGCAAGG + Intronic
1001536970 5:172504870-172504892 GAGGAGAAACAGAAAATGCAGGG + Intergenic
1001785595 5:174409905-174409927 AGGTATGAACGGAATATGGATGG - Intergenic
1002585597 5:180245035-180245057 AGGGACAAAGGGAATAGGGAAGG - Intronic
1003366086 6:5476197-5476219 GGAGAGAACCAGGATATGGATGG + Intronic
1003626469 6:7745976-7745998 AGAGAGAGAGAGAATATTGAGGG + Intronic
1003862247 6:10333044-10333066 AGGGAGAGATAGAATATGCTTGG - Intergenic
1004531019 6:16455993-16456015 GGACAGAAACAGAATATGGGAGG + Intronic
1004785589 6:18964118-18964140 AGAGAGAATCAGGATATGGTGGG - Intergenic
1005149817 6:22735994-22736016 AGGGAGGAAGAGAAGACGGAAGG - Intergenic
1005327123 6:24712997-24713019 AGGGAGAAAATGAATATAAAAGG - Intronic
1005472753 6:26178052-26178074 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1005562245 6:27052545-27052567 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1006032365 6:31186519-31186541 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1006722725 6:36169058-36169080 AGGGCAAAACAAAATTTGGAGGG - Intergenic
1007024983 6:38562260-38562282 AGGAAGAAACTGAAGAGGGAAGG - Intronic
1007035127 6:38666192-38666214 TGGGAGGAACAGGAAATGGAGGG + Intergenic
1007124908 6:39417874-39417896 AGGGAGAAACAGTTTATAAAAGG + Intronic
1007509196 6:42362526-42362548 AGGGACAAACTGAGAATGGAAGG + Intronic
1007865317 6:44962876-44962898 AGGGAGACAGAAAATAAGGAAGG - Intronic
1008121886 6:47627827-47627849 AGATGGAAACAGAATCTGGAAGG + Intergenic
1008357346 6:50570234-50570256 AGGAAAAAACAGAATCTGCAGGG + Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1009357281 6:62766418-62766440 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1009406366 6:63318425-63318447 AGGAAGTGAAAGAATATGGAAGG - Intronic
1009564424 6:65293976-65293998 AGGGAGAGAAAGCAAATGGAGGG + Intronic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1009900494 6:69803010-69803032 AGGAAGACACAGAATTTGAAGGG + Intergenic
1010317557 6:74468372-74468394 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1010507991 6:76684333-76684355 AGTGAGAAAAAGCACATGGAAGG - Intergenic
1010513980 6:76751393-76751415 AGGGAGAGAAAGCAGATGGAGGG + Intergenic
1010751484 6:79620637-79620659 AGAGAGAAAAAGAACATGTATGG + Intergenic
1011085625 6:83537435-83537457 AGAGAGAAAAAGAAAAGGGAGGG - Intergenic
1011360343 6:86517375-86517397 AGGGAGAAATATAACCTGGAAGG - Intergenic
1011458150 6:87574571-87574593 AGGGAGAGAGAGAATAGGGAGGG + Intronic
1011770029 6:90665442-90665464 AGGGAGAAAGAGAGAAAGGAAGG - Intergenic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1013496631 6:110704379-110704401 AGGGAGAAAAAGATAATGTAAGG - Intronic
1013536755 6:111069565-111069587 AGGCAGAATCAGAGAATGGATGG - Intergenic
1013558868 6:111284399-111284421 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1013559507 6:111290373-111290395 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1013699392 6:112745857-112745879 AGGGAGAAACAGAAAATATTAGG - Intergenic
1013787913 6:113802950-113802972 AGAGAGAAAGAGAAAAAGGAAGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014137378 6:117906096-117906118 GAGGAGAAAAGGAATATGGAAGG - Intergenic
1014772204 6:125469683-125469705 AGGGAGAAATGTAATTTGGAGGG - Intergenic
1015254400 6:131162015-131162037 AGGGAGAAGCAGAAAATGAGCGG - Intronic
1015766958 6:136728934-136728956 AGGGAGAAACCTAGTGTGGAGGG + Intronic
1015902416 6:138081812-138081834 AGGCAAAAACAGTACATGGAAGG + Intergenic
1016131997 6:140485484-140485506 AGGGAAAAACAGATCATGGATGG - Intergenic
1016449034 6:144162127-144162149 AGGGTGGAACAGAGGATGGAGGG + Intronic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1017100804 6:150848283-150848305 AGGCAGAGACAGATTATGGGGGG - Intergenic
1017226139 6:152022991-152023013 AGAGAGAAAAAGAAAAAGGATGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1018769529 6:166958507-166958529 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1018771257 6:166973275-166973297 AGGCACAAACAAAATAAGGAAGG + Intergenic
1019021907 6:168925920-168925942 AGGAAGGAGCAGAAGATGGAAGG - Intergenic
1020749047 7:12116266-12116288 AGAGATTAACAGATTATGGAGGG + Intergenic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021081324 7:16369308-16369330 AGAGAGAAACAGAACAGGGCAGG + Intronic
1021154795 7:17196605-17196627 AGAAAGAAAGAAAATATGGATGG - Intergenic
1021169605 7:17382827-17382849 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1021586308 7:22212336-22212358 AGAGAGAGACAGAATCTGAAGGG - Intronic
1021862620 7:24922187-24922209 GGTGAGAAACAGAAAATAGAAGG + Intronic
1021900070 7:25276373-25276395 AGAGAGTCACAGAACATGGAAGG + Intergenic
1022337819 7:29438754-29438776 AGGGAGATACAAAATATGAAGGG - Intronic
1022445832 7:30469944-30469966 GGGGAGAAACAGAGTAAGGTGGG - Intronic
1023175564 7:37432357-37432379 AGGGAGAAAGGGGATATGAAAGG + Intronic
1023351011 7:39320231-39320253 ACGGAGATTCAGAATCTGGAAGG - Intronic
1023466756 7:40464448-40464470 AGGGACAAACAGAATTAGGCAGG + Intronic
1023633880 7:42189554-42189576 TGGAAGAAATAAAATATGGAAGG + Intronic
1026319269 7:69254802-69254824 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
1026404818 7:70054307-70054329 AGTGAGAAAGAGAAGATAGAAGG - Intronic
1027350263 7:77304882-77304904 AGAGAGAAACAGAACAGGGCAGG + Intronic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028789064 7:94832846-94832868 AGATAGAAAAAGAAAATGGATGG - Intergenic
1028842039 7:95439137-95439159 AGGGATAAAAGGAATATGGAGGG - Intergenic
1028900317 7:96092217-96092239 AAGAAGAAAGAGAATATGCAAGG + Intronic
1029395562 7:100306101-100306123 AGGCACAAACTGAATGTGGAAGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029449412 7:100632528-100632550 AGAGAGAAACAGAGAAGGGAGGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030731081 7:112990161-112990183 AGAGAGAAACTGAATATTGATGG - Intergenic
1031106858 7:117554433-117554455 TGGGAGAAACAGGTTTTGGATGG + Intronic
1031257039 7:119466402-119466424 AGGGAGGAAGAGAATATGAAAGG - Intergenic
1032172337 7:129595539-129595561 AGGTAGAAGGAGAATATTGAAGG + Intergenic
1032281900 7:130510425-130510447 AAAGAGATACAGAATATGGTAGG + Intronic
1032581294 7:133105700-133105722 AGGGGCAAACAGTCTATGGAGGG - Intergenic
1032782088 7:135171492-135171514 AGGGAGAAACAGAACAGGGCAGG - Intergenic
1032826970 7:135580349-135580371 GGTGAGAAACAGAATTTGTACGG - Intronic
1033011459 7:137626803-137626825 AGGGAGAAACAGACTATCAGTGG - Intronic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1033611303 7:142965522-142965544 ATGGAGAAACAGATCATGGGGGG + Intergenic
1033713189 7:143971113-143971135 AGGAAGAAAAATAATAAGGAAGG + Intergenic
1034121475 7:148631804-148631826 AAGGAGAAAAACAAGATGGATGG + Intergenic
1034551907 7:151826130-151826152 ATGGAGAAAGAGAGAATGGATGG - Intronic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037066505 8:14584871-14584893 AGAAAGAAACAGAATATGTAAGG + Intronic
1037356820 8:18029475-18029497 AGAGAGAAACACAGTATGTAAGG - Intronic
1037419248 8:18684454-18684476 AGGAAGAAAAAAAATATGGATGG + Intronic
1037680441 8:21092811-21092833 AGGAAGAAAGAAAAGATGGAAGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038131033 8:24731903-24731925 AGGGAGAAAAAAAATAGGGTAGG + Intergenic
1038913349 8:31992215-31992237 AGAAAGAAACAGAAAATGGGAGG + Intronic
1039236610 8:35509185-35509207 ACGGAGAAATAGTATATGGTGGG + Intronic
1039328716 8:36513404-36513426 AGGTCTAAACAGAATAGGGAAGG - Intergenic
1040021063 8:42741742-42741764 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1040113021 8:43580933-43580955 AGAGAAAAACAGAATATTCATGG + Intergenic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1041170075 8:55132381-55132403 AGGGAAAAACAGTATATATACGG - Intronic
1041921732 8:63189355-63189377 AGGTGGAAAGAGAAAATGGATGG + Intronic
1042175480 8:66033870-66033892 AGGTGGAAAGAGAATTTGGATGG + Intronic
1042188798 8:66164886-66164908 AGGGAGGAAAGGAAAATGGAAGG + Intronic
1042355683 8:67824955-67824977 AGAGAGAAACAGAACACGGCAGG - Intergenic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043391018 8:79791763-79791785 AGAGAGATAAAGAATATGGAAGG - Intergenic
1044111388 8:88279703-88279725 ATGGAAAAACAAAATATGGAGGG + Intronic
1044142760 8:88675108-88675130 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044889893 8:96823230-96823252 AGGGAGAAAATGGAAATGGAGGG + Intronic
1045085991 8:98686240-98686262 AGGGAGTAAAAGAATACAGAAGG + Intronic
1045415981 8:101968012-101968034 AAAGAGAAACAGAATATGATTGG + Intronic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1045834131 8:106500410-106500432 AGAGAGAAACAGAACAGGGCAGG - Intronic
1046656555 8:116900922-116900944 AGGGAAAAAAAGAATATAAATGG + Intergenic
1046667937 8:117025616-117025638 ATGGAAAAAGAGAATATGAATGG - Intronic
1046991733 8:120465256-120465278 AGGGAGGAAAGGAATATAGATGG + Intronic
1047605217 8:126467690-126467712 AGGGAGAAACTAATTTTGGAAGG + Intergenic
1047731976 8:127735819-127735841 AGGGAGCAAAAGAAAATGGTAGG + Intronic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1048398754 8:134042663-134042685 AGGGAGAAACTGACTATGCCAGG - Intergenic
1048524031 8:135184821-135184843 AGGGAGGAATAGAATGTGCAAGG - Intergenic
1048915498 8:139178927-139178949 AGGGAGAAACAGAACAGGGCAGG + Intergenic
1050138495 9:2493455-2493477 AGAGAGAAACACAAAAGGGAGGG + Intergenic
1050197597 9:3104054-3104076 AAAGAGAAACAAACTATGGAGGG + Intergenic
1050938758 9:11431755-11431777 AGGGAGAAAAAGAAAAAGAAGGG + Intergenic
1051187086 9:14471690-14471712 AGGGAAAAACAGAGAATAGATGG - Intergenic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052275457 9:26670702-26670724 AGGGAGTAACAAAGTAGGGAAGG - Intergenic
1052345296 9:27403313-27403335 AAGGAGAAACAAAGTATGAAAGG + Intronic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1052661875 9:31443937-31443959 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1052734978 9:32332703-32332725 TGGCAGAAGCAGAATATGGTTGG + Intergenic
1052983465 9:34466913-34466935 AGGGAGAACCAGCAGTTGGATGG - Intronic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053534546 9:38912891-38912913 AGAGAGACACAGACTATAGATGG - Intergenic
1053627517 9:39890171-39890193 TAGAAGAAACAGAATATTGAAGG + Intergenic
1053641808 9:40089566-40089588 AGGAAGAAACATAATATGAAAGG + Intergenic
1053764328 9:41375898-41375920 AGGAAGAAACATAATATGAAAGG - Intergenic
1053778476 9:41575849-41575871 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054166438 9:61786093-61786115 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054206765 9:62137311-62137333 AGAGAGACACAGACTATAGATGG - Intergenic
1054216370 9:62360532-62360554 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054322698 9:63686955-63686977 AGGAAGAAACATAATATGAAAGG + Intergenic
1054542943 9:66287076-66287098 AGGAAGAAACATAATATGAAAGG - Intergenic
1054631587 9:67451036-67451058 AGAGAGACACAGACTATAGATGG + Intergenic
1054671111 9:67794811-67794833 TAGAAGAAACAGAATATTGAAGG + Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1055122606 9:72679631-72679653 ATGGAGACACAGCAAATGGATGG - Intronic
1056095273 9:83246633-83246655 AGAGAGAGAGAGAATATGAATGG - Exonic
1057390867 9:94640469-94640491 AGGAAGACACGGAATGTGGAGGG + Intergenic
1057509381 9:95664999-95665021 GGACAGAAACAGAACATGGAAGG + Intergenic
1057788845 9:98109224-98109246 AGGGAGCAACAGAGGATGAAGGG + Intronic
1057788851 9:98109251-98109273 AGGGAGCAACAGAGGATGAAAGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058962631 9:110006260-110006282 AGAGAGAGAGAGAAAATGGAAGG - Intronic
1059524997 9:114983149-114983171 AGGGAGAATTGGAATCTGGAAGG + Intergenic
1059556938 9:115290844-115290866 TGGTAGAAACATAAGATGGAAGG + Intronic
1059665545 9:116443211-116443233 AGGAAGAACCAGTTTATGGAAGG + Intronic
1059694769 9:116720681-116720703 ATAGAGAAACTGACTATGGAAGG - Intronic
1060165716 9:121412849-121412871 AGGGAGAGACAGAGGAGGGAGGG - Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060318916 9:122537229-122537251 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1060340856 9:122775844-122775866 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1060575418 9:124687912-124687934 AGGCAGAAACATAATATATATGG - Intronic
1060644213 9:125264158-125264180 AGGGAGATAAAAAATTTGGATGG + Intronic
1061035711 9:128113320-128113342 GGGGAGAAAGAGAAGATGGATGG - Intergenic
1061575902 9:131505858-131505880 AGGGAGAGACAGAATCTGTATGG + Intronic
1061688086 9:132300226-132300248 AGGGAGAAACATACAACGGATGG + Intronic
1061805622 9:133136222-133136244 AGGCAAAAACAGAACAGGGAAGG + Intronic
1202789586 9_KI270719v1_random:72642-72664 AGGAAGAAACATAATATGAAAGG + Intergenic
1203654033 Un_KI270752v1:6531-6553 AGGGAGAAAGTGAATAAGGATGG - Intergenic
1185492335 X:527210-527232 AGGAAGAAAAGGAATAAGGAAGG - Intergenic
1185492473 X:528487-528509 AGGAAGAAAAGGAATAAGGAAGG - Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185895956 X:3859134-3859156 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1185901075 X:3897558-3897580 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1185906189 X:3935997-3936019 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1186013361 X:5163138-5163160 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1187270302 X:17774734-17774756 AGGCAGAAACAGATTATGTGTGG - Intergenic
1187730880 X:22253092-22253114 TGGCAGAACCATAATATGGAAGG - Intergenic
1188299839 X:28495227-28495249 AGTTGGAAACAGAATATGCATGG - Intergenic
1188337019 X:28948792-28948814 AGGGAAAAACAGTATATATAGGG - Intronic
1188432841 X:30125685-30125707 TGGCAGAAACAGAATAATGAGGG + Intergenic
1188691977 X:33140532-33140554 ACTGAGAATCAGAAAATGGAGGG - Intronic
1188774942 X:34204623-34204645 AGGGGAAAACACAATATTGAGGG - Intergenic
1188897929 X:35693523-35693545 AGGGAGGAACAGAACAGGGCAGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190639785 X:52473145-52473167 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1191228528 X:58073304-58073326 AAGGAAAAACAGAATATCCAGGG - Intergenic
1191825894 X:65364289-65364311 AGGGTGGTACAGGATATGGAAGG - Intergenic
1191915969 X:66201441-66201463 AGGAAGAAAAAGGATATAGAGGG - Intronic
1192074990 X:67985019-67985041 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1192780943 X:74293313-74293335 GGGGAAGAACAGAACATGGAGGG - Intergenic
1193156513 X:78180072-78180094 ATGGAGAACCAGAATATGTAGGG - Intergenic
1193186059 X:78514102-78514124 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1193538823 X:82745990-82746012 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1193696525 X:84713378-84713400 AGGGAGATACAGGAGAGGGAAGG - Intergenic
1193791332 X:85818860-85818882 TGGGAGAAACAAAAAAGGGATGG + Intergenic
1194318963 X:92419632-92419654 AGAGAGAAACAGAAAAGAGAAGG - Intronic
1194650315 X:96506406-96506428 AGAGAAAAACAAAATGTGGAGGG + Intergenic
1194877842 X:99211195-99211217 ACTGAGAATGAGAATATGGAAGG - Intergenic
1195157702 X:102140850-102140872 AGGAAAAAACAGAAAATGGGTGG - Exonic
1195170182 X:102259767-102259789 AGGAAGAGACAGAATATGAAAGG - Intergenic
1195188675 X:102427333-102427355 AGGAAGAGACAGAATATGAAAGG + Intronic
1195275066 X:103274064-103274086 AGGAAAAAACAGAAAATGGGTGG - Exonic
1195303545 X:103556163-103556185 AGTGAGACCCAGAAAATGGAAGG - Intergenic
1195308747 X:103609524-103609546 AGGAAAAAACAGAAAATGGGTGG + Exonic
1195801492 X:108716697-108716719 AGGGAGAATCATAACAGGGAGGG + Intergenic
1196252094 X:113473162-113473184 AGAGAGAAACAGAAGAGGGCAGG + Intergenic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197114240 X:122813726-122813748 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1198527707 X:137518778-137518800 AGGGAGAAACAGCATAAGCGAGG + Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1199162850 X:144634614-144634636 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199435114 X:147804457-147804479 AGAGAGAAAGAGAAGAGGGAAGG + Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200627093 Y:5532792-5532814 AGAGAGAAACAGAAAAGGGAAGG - Intronic
1200695771 Y:6357867-6357889 AGGGAGAAAAAGAGAATGAAAGG - Intergenic
1201039506 Y:9816843-9816865 AGGGAGAAAAAGAGAATGAAAGG + Intergenic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201336413 Y:12885543-12885565 AGGCAGAAACAGAAAATTGAAGG - Intergenic
1201372676 Y:13282526-13282548 AGAGAGAAACAGAACAAGGCAGG - Intronic
1201373357 Y:13289470-13289492 AGAGAGAAACAGAACAAGGCAGG - Intronic
1201390683 Y:13493853-13493875 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1201438471 Y:13985084-13985106 AGGGAGGAACAGAAGGTGGGTGG - Intergenic
1201446102 Y:14057624-14057646 AGGGAGGAACAGAAGGTGGGTGG + Intergenic
1201458923 Y:14201313-14201335 AGGGAGGAAGAAAATAAGGAAGG + Intergenic
1202169308 Y:22024123-22024145 GGCCAGAATCAGAATATGGAAGG - Intergenic