ID: 911913063 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:103660003-103660025 |
| Sequence | TCATTTAGAGGCACTCCAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 157 | |||
| Summary | {0: 6, 1: 0, 2: 2, 3: 11, 4: 138} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911913063_911913065 | 1 | Left | 911913063 | 1:103660003-103660025 | CCTTCTGGAGTGCCTCTAAATGA | 0: 6 1: 0 2: 2 3: 11 4: 138 |
||
| Right | 911913065 | 1:103660027-103660049 | AATGTGCTGAAACCTCTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911913063 | Original CRISPR | TCATTTAGAGGCACTCCAGA AGG (reversed) | Intronic | ||