ID: 911913063

View in Genome Browser
Species Human (GRCh38)
Location 1:103660003-103660025
Sequence TCATTTAGAGGCACTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 6, 1: 0, 2: 2, 3: 11, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911913063_911913065 1 Left 911913063 1:103660003-103660025 CCTTCTGGAGTGCCTCTAAATGA 0: 6
1: 0
2: 2
3: 11
4: 138
Right 911913065 1:103660027-103660049 AATGTGCTGAAACCTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911913063 Original CRISPR TCATTTAGAGGCACTCCAGA AGG (reversed) Intronic