ID: 911915392 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:103691945-103691967 |
| Sequence | TCATTTAGAGGCACTCCAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911915390_911915392 | 1 | Left | 911915390 | 1:103691921-103691943 | CCTTTCAGAGGTTTCAGCACATT | No data | ||
| Right | 911915392 | 1:103691945-103691967 | TCATTTAGAGGCACTCCAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911915392 | Original CRISPR | TCATTTAGAGGCACTCCAGA AGG | Intronic | ||