ID: 911915392

View in Genome Browser
Species Human (GRCh38)
Location 1:103691945-103691967
Sequence TCATTTAGAGGCACTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911915390_911915392 1 Left 911915390 1:103691921-103691943 CCTTTCAGAGGTTTCAGCACATT No data
Right 911915392 1:103691945-103691967 TCATTTAGAGGCACTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911915392 Original CRISPR TCATTTAGAGGCACTCCAGA AGG Intronic