ID: 911915727

View in Genome Browser
Species Human (GRCh38)
Location 1:103696644-103696666
Sequence AGGGAGAAACAGAATACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 2, 2: 1, 3: 37, 4: 505}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911915727_911915734 15 Left 911915727 1:103696644-103696666 CCTTCCGTATTCTGTTTCTCCCT 0: 1
1: 2
2: 1
3: 37
4: 505
Right 911915734 1:103696682-103696704 TAGTCCTTGTCGCATATCCCTGG 0: 3
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911915727 Original CRISPR AGGGAGAAACAGAATACGGA AGG (reversed) Intronic
900202753 1:1418606-1418628 AGAGAGAAACAGAACACGGCAGG + Exonic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
902027275 1:13393530-13393552 AGGAAGAAACAGATGACTGAAGG - Intergenic
902219664 1:14957050-14957072 ACGAAGAAACAGAACACGGAAGG - Intronic
902469983 1:16642588-16642610 AGGAAGAAGCAGCGTACGGAAGG + Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
904117544 1:28173813-28173835 AGAGAGAGACAGAATATGCAGGG - Intronic
904170296 1:28587135-28587157 AGAGAGAAACAGAACAGGGTAGG + Intergenic
904573150 1:31483099-31483121 AGAGAGAAACAGAACAGGGCAGG + Intergenic
906498911 1:46325777-46325799 AGAGAGAAACAGAACAGGGCAGG + Intergenic
906499659 1:46332298-46332320 AGAGAGAAACAGAACAGGGCAGG + Intergenic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
909106382 1:71414711-71414733 GGGGAGAAAAAGACTACAGAGGG - Intronic
909520801 1:76565479-76565501 AGAGAGGAAGAGAAAACGGAAGG - Intronic
910415795 1:86996665-86996687 ATGGAGAAACAGACAACTGAAGG + Intronic
910502032 1:87903354-87903376 AGGGAGAGAGAGCATACTGATGG + Intergenic
911313592 1:96328178-96328200 ACGGAAAAAAAGAATACGAATGG + Intergenic
911396164 1:97313596-97313618 AATGAGAAACAGAATAGAGAAGG - Intronic
911495553 1:98627048-98627070 AGACAGAAACAGAATCCTGAGGG - Intergenic
911909622 1:103616418-103616440 AGGGAGAAACAGAACAGGGCAGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
912336886 1:108871522-108871544 AGAGTGAAACAGGATAGGGAAGG - Intronic
912617279 1:111115846-111115868 AGGGAAAAACAGTATATAGAGGG - Intergenic
912676621 1:111687623-111687645 AGAGAGAAATAGAATACTTAAGG - Intronic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
914340023 1:146752503-146752525 AGGGAGAAAGAGAATCCTGTTGG - Intergenic
915790379 1:158663301-158663323 AGAGAGAGAAAGAATACAGAAGG - Intronic
916232193 1:162551448-162551470 AGGGAGAGAGGGAATAAGGAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
917117311 1:171615653-171615675 AGAGAGAAACAGAACAGGGCAGG - Intergenic
917739067 1:177945808-177945830 AGAGAGATACAGAACAGGGAGGG + Intronic
917802530 1:178583323-178583345 AGGGAGAAACAGTATATATAGGG - Intergenic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919334690 1:196217238-196217260 AGAGAGAAACAGAACAGGGCAGG + Intergenic
920095951 1:203486948-203486970 AGGGAGAGAGAGAAAACGAATGG - Exonic
920351749 1:205342578-205342600 AGGGAGGAAGAGGAGACGGAGGG + Intronic
920449962 1:206052750-206052772 AGAGAGAAACAGAACAGGGCAGG - Exonic
920450608 1:206058662-206058684 AGAGAGAAACAGAACAGGGCAGG - Intronic
922195201 1:223353678-223353700 AGGGAGAATCTGTATCCGGAGGG + Intronic
923443265 1:234041363-234041385 AGGGGGAAAAGGACTACGGAGGG + Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
1063049429 10:2430813-2430835 AGGAAGAAAGAAAATAAGGAAGG + Intergenic
1063194194 10:3725737-3725759 AGAGAGAAACAAAACACAGAGGG - Intergenic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1064199403 10:13271901-13271923 CGTGAGAAACAGAAAACAGATGG - Intergenic
1064512386 10:16109878-16109900 AGGGAGAAGCAGAGGACGGGAGG + Intergenic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065639799 10:27770269-27770291 AGAGAGAAAGAGAAAATGGAAGG - Intergenic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065674749 10:28162838-28162860 AGTGAGAGAAAGAATATGGAGGG - Intronic
1065694836 10:28370217-28370239 AGGGAGAAAGAGAGGATGGAAGG + Intergenic
1065801993 10:29360663-29360685 AGGGAGGAACAGAACAGGGCAGG + Intergenic
1066065066 10:31755934-31755956 AGGGGGAAAAAGAAAACAGAAGG + Intergenic
1066790088 10:39052625-39052647 AGGGATAAACTGAATACCCAAGG + Intergenic
1067354927 10:45515399-45515421 AGCGAGGAACAGAATACTCATGG - Intronic
1068201427 10:53788627-53788649 AGGGAGAAAGAGAGAAAGGAAGG + Intergenic
1068351096 10:55846084-55846106 AGGGAGAAAGAGAATTTGAAGGG + Intergenic
1069320102 10:67159143-67159165 AGAGAGAAACAGAACAGGGCAGG - Intronic
1069362701 10:67661269-67661291 AGGAAGAAAGAGAAAAAGGAGGG + Intronic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071288121 10:84167414-84167436 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1071288625 10:84172215-84172237 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1072688759 10:97555690-97555712 AGAGAGAAACAGAACAGGGCAGG + Intronic
1072832213 10:98670748-98670770 AGAGAGAAACAGAACAGGGCAGG - Intronic
1074552989 10:114462456-114462478 AGGCAGGAACAGAAAACAGAAGG + Intronic
1074643320 10:115414309-115414331 AGGGAGTAAGAGAAGAGGGAGGG - Intronic
1075847263 10:125555017-125555039 AGGAAGACACAGAAGAGGGAAGG - Intergenic
1076019070 10:127055565-127055587 AGGGAGAAATAGATAATGGATGG + Intronic
1077840577 11:5970448-5970470 AGAGAGAAATAGAATGCGGGAGG + Intergenic
1077947116 11:6911793-6911815 AGGGAGACAATGAAGACGGAAGG - Intergenic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080381785 11:31779389-31779411 TGGGAGAAACGGAATTAGGAAGG + Intronic
1082677313 11:56121853-56121875 AGGGAAAAAAAGAGTATGGAAGG - Intergenic
1083537310 11:63481467-63481489 AGGGACAAACAGAATTCAGAAGG - Intronic
1084470273 11:69355478-69355500 TGGGAGGCACAGAATAAGGAGGG - Intronic
1084527508 11:69705957-69705979 AGGGAGGAATAGAATACTGTGGG - Intergenic
1085118804 11:73953553-73953575 AGAGAGAAACAGAACAGGGCAGG + Intronic
1085240440 11:75049619-75049641 AGGGAGGAACAGAACAGGGCAGG + Intergenic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1086824682 11:91481924-91481946 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1088226531 11:107626489-107626511 AGGAAGGAAGAGAATAAGGAAGG - Intronic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1089120070 11:116127613-116127635 AGAGAGAAACAAAAAACAGAGGG + Intergenic
1089436518 11:118473472-118473494 AGGAAGAGACAGAAGACGGGGGG - Exonic
1090488310 11:127134987-127135009 AAGCAGAAATAGAATACGAATGG + Intergenic
1090532577 11:127606380-127606402 TGGGAGAAATAGTATTCGGATGG - Intergenic
1090833845 11:130439398-130439420 AGGGAGAAAAAGGAGAGGGAGGG + Intergenic
1090937401 11:131355951-131355973 AGGAAGAAACAGAATATGAAAGG - Intergenic
1091114740 11:133002714-133002736 AGGGAGAAAGAGAGGAGGGAAGG + Intronic
1091118436 11:133036988-133037010 CGGGAGAAACAGAACACTGTGGG - Intronic
1091517390 12:1198377-1198399 AGAGAGATACAGAATACAGAGGG + Intronic
1092570205 12:9713159-9713181 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1092798516 12:12139108-12139130 AGGGAGAAACTGAATAAAGCAGG - Intronic
1094385287 12:29887126-29887148 AGAGAGGAACAGAAAACAGAAGG + Intergenic
1095475285 12:42580937-42580959 AGGGAGAGAGAGAGTAAGGAAGG + Intronic
1096286031 12:50301127-50301149 AGGGAGAAAAAGAAAATGAAAGG + Intergenic
1096993894 12:55827221-55827243 AGAGAGAAACAGGAAACAGAAGG + Intronic
1097805329 12:63958843-63958865 AGGCAGAAAAAGAACACCGAGGG - Intronic
1098083260 12:66812549-66812571 GGTGTGAAACAGAATATGGAGGG + Intergenic
1099462370 12:82939396-82939418 AGAGAGACACAAAATACAGAGGG - Intronic
1099961575 12:89402132-89402154 AGGGAGAAACAAAAAAGAGAAGG - Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1101329353 12:103744949-103744971 AGGGAAAAACATAATAGAGAAGG - Intronic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101783366 12:107858864-107858886 AGTGAGAAACAGAAAAGGAAAGG + Intergenic
1102074619 12:110049860-110049882 AGAGAGAAACAGAACAGGGCAGG - Intronic
1103060789 12:117856747-117856769 AGGGTGAAATAGCCTACGGATGG + Intronic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1104136328 12:125942840-125942862 AGGGATAAACAGAACATGAAGGG - Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1106973328 13:35173164-35173186 AGAGGGTAACAGAATAAGGAAGG + Intronic
1107710845 13:43149160-43149182 AGGGAGAAACAGGCTACATACGG + Intergenic
1107905372 13:45056636-45056658 AGGGAGAAACAGAAAAAAGGAGG - Intergenic
1107997055 13:45871353-45871375 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1108253796 13:48591666-48591688 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1108552140 13:51557132-51557154 AGGCAGAACCATAATACGGAAGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1109812978 13:67539902-67539924 AGGGAGATAAAGAATGCAGAAGG - Intergenic
1110288164 13:73773800-73773822 AGCAAGAAACAGAAAACAGAAGG - Intronic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1111932422 13:94525507-94525529 AGGGAAAGACAGAATAAAGATGG - Intergenic
1112150706 13:96759344-96759366 AAGGAGAAACAGAAAACTGATGG - Intronic
1112792651 13:103019743-103019765 AAGGAGTAACAGAAAAGGGACGG - Intergenic
1113017781 13:105847572-105847594 TGGCATAAACAGAATACTGACGG + Intergenic
1113239546 13:108321075-108321097 ACGGAGAAACATAATACAGTAGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113247918 13:108419713-108419735 AGGGAGAAACACCATAAGGTAGG + Intergenic
1114378507 14:22175261-22175283 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1114709250 14:24761645-24761667 AGGGATAAACAGCAAACAGAGGG - Intergenic
1116057051 14:39876691-39876713 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1119032053 14:71200454-71200476 AGGGTGAGACAGAGTAGGGACGG - Intergenic
1119838204 14:77770205-77770227 AAGGACAAACAGAATATGTATGG - Intergenic
1120020950 14:79529264-79529286 AGAGAGAAACAGAACAGGGCAGG + Intronic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1121349938 14:93165343-93165365 AGAGAGAAACAGAACACGGCAGG - Intergenic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121701430 14:95957302-95957324 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1124187115 15:27541002-27541024 AGGGAGAAAGAGAGGACAGAGGG + Exonic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1129167254 15:73785690-73785712 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1129227598 15:74179082-74179104 GAGGAGAATGAGAATACGGAGGG - Intergenic
1129844840 15:78763519-78763541 AGGGAGAAACAGACAAGGAAAGG - Intronic
1129982911 15:79890543-79890565 AGGGAGGAACAGAAAAGGAAGGG - Intronic
1130256982 15:82330334-82330356 AGGGAGAAACAGACAAGGAAAGG + Intergenic
1130597966 15:85259654-85259676 AGGGAGAAACAGACAAGGAAAGG - Intergenic
1131893262 15:96997504-96997526 AGGCAGAGACAGAAAAGGGAAGG - Intergenic
1136350997 16:29707718-29707740 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137847774 16:51709016-51709038 AGAGAGACAGAGAATACAGAAGG + Intergenic
1137922250 16:52501933-52501955 AGGCAGCAACAGAATAGAGAAGG + Intronic
1138206295 16:55127627-55127649 AGTGAGAAAAAGAGTGCGGAGGG - Intergenic
1138867068 16:60834767-60834789 AGATAGAAACAGAATACTGTGGG + Intergenic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139577511 16:67851185-67851207 AGAGAGACACAGAATAGGCAGGG + Intronic
1141373412 16:83508042-83508064 AGAGAGAAAGAGAAGAAGGAAGG + Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1142489156 17:266711-266733 AGTGAGAAACAGAATTCTGAGGG + Intronic
1143014995 17:3887006-3887028 AGGGAGACCCAGAGTACGCATGG + Intronic
1143715705 17:8767205-8767227 AAGGAGAAAAAGAAAATGGATGG - Intergenic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1146474215 17:33149804-33149826 AGGGAAAAATACAATACAGATGG - Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150771996 17:68050193-68050215 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150772007 17:68050257-68050279 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1152050907 17:77976162-77976184 AGTGAGAAACAGACTACGCAGGG - Intergenic
1203156471 17_GL000205v2_random:8603-8625 AGGGACAAACAGAACACAGCAGG + Intergenic
1155486252 18:26345889-26345911 TGTGAGATACAGAATACTGATGG + Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156860060 18:41825661-41825683 GGAGAGAAACATAATACGGATGG + Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159671875 18:71230766-71230788 AGACAGACACAGAATATGGATGG - Intergenic
1159689813 18:71472484-71472506 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1159953241 18:74500895-74500917 AGAGAGAAACAGAACAGGGCAGG + Intronic
1161027974 19:2045437-2045459 AGGGACAGACACAGTACGGACGG - Intronic
1162700603 19:12512229-12512251 AGGGAGAAAAACTATACCGAAGG - Intronic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163207427 19:15813879-15813901 AGGGAGAAAGAGAGGACAGAGGG + Intergenic
1163907722 19:20161660-20161682 AGGGAGGAACAGAACAGGGCAGG - Intergenic
1163934165 19:20426352-20426374 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1163934708 19:20432349-20432371 AGGGAGGAACAGAACAGGGCGGG + Intergenic
1164234509 19:23320526-23320548 AGGGAGAAAGTGAATAAAGAAGG + Intronic
1164571342 19:29376827-29376849 AGGCAGAAACAGAAAAGAGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166544052 19:43623552-43623574 AGGGAGAAACGGAACACACAGGG + Intronic
1166787183 19:45375071-45375093 AGGGAGAAAGAGAGAAAGGATGG + Intergenic
1167604299 19:50473288-50473310 AGGGAGAAATAGAGGAAGGAGGG - Intronic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167938131 19:52923855-52923877 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1168346277 19:55651609-55651631 AGGGAGAGACAGAACCCGGTGGG - Intronic
1168425213 19:56234669-56234691 AGAGAGAAACAGAACAGGGCAGG - Intronic
1168607060 19:57768635-57768657 AGGGAGGAACAGAACAGGGCAGG + Intergenic
925466538 2:4111111-4111133 AGGGAGAGAAAGGAAACGGAGGG - Intergenic
925684079 2:6453285-6453307 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
925881709 2:8358120-8358142 AGGGAGAGACAGGAGATGGAGGG + Intergenic
928768558 2:34677412-34677434 AGAGAGAAACAGAACAGGGCAGG - Intergenic
929307303 2:40378207-40378229 AGGGGGAAACAGTATATGGAAGG + Intronic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929419728 2:41778443-41778465 GGGAAGAAATAGAATAGGGAGGG - Intergenic
931730327 2:65147501-65147523 AGGGAGGAAAAAAATAAGGAAGG + Intergenic
932178533 2:69624043-69624065 AGGGAGAAAAAGAAAAGAGAAGG + Intronic
932216004 2:69966310-69966332 AGGCAGAAACCCAATTCGGAGGG - Intergenic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933601794 2:84339613-84339635 AGGGAGAGAAAGAATACTGGGGG - Intergenic
933836695 2:86251602-86251624 TGGGAGAAACAGAAGAGGGCAGG - Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
937859255 2:126695343-126695365 AGGAAGAAAAAGAAAAGGGAGGG + Intronic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
938812008 2:134862415-134862437 AGGGAAAAACACAATTCAGAAGG + Intronic
939718930 2:145622833-145622855 AGGGAGGAACAAAAGACAGAAGG - Intergenic
940578456 2:155546182-155546204 AGGGAGAGACAGAACAAGGGAGG + Intergenic
941173219 2:162164783-162164805 AGACAGAAACAGAATAAGCATGG + Intergenic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943714316 2:191133696-191133718 AGGGAGAAAGACAAAAAGGAAGG + Intronic
943936964 2:193931647-193931669 AGGGAGAAAAGGAAAAAGGAAGG + Intergenic
944642885 2:201745999-201746021 AGGGAAAAACAGAACACTGTTGG + Intronic
944724107 2:202452151-202452173 AGGGGCAAACAGAATACAAAGGG - Intronic
945688791 2:213007160-213007182 AGGAAGAAACAGAAGAGAGAAGG - Exonic
945771656 2:214050747-214050769 AGGGAGAAAAAGAAGATGGGAGG - Intronic
946169493 2:217886176-217886198 AGGGAGAAAGAGAGAAAGGAAGG + Intronic
946606553 2:221411485-221411507 AGGGAGGAAGAGAAAAGGGAAGG + Intergenic
946949470 2:224857487-224857509 AGAGACAAAGATAATACGGAAGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
948124672 2:235556036-235556058 AGGGAGAAACAGCATCCTGCAGG + Intronic
948897978 2:240936144-240936166 AGGCAGAATCTGAAAACGGAAGG - Intronic
1169565214 20:6846658-6846680 AGGGAGAAAAAGCATATGGTTGG + Intergenic
1169600849 20:7259096-7259118 AGGAAGAAAAAGAATGCAGAAGG - Intergenic
1169668559 20:8068303-8068325 AGGCAGAAAGAGAGTAGGGAAGG + Intergenic
1169744969 20:8934482-8934504 AGGCAGAAACACAAAATGGAAGG + Intronic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1169965767 20:11215493-11215515 GTCGAGAAACAGAATACGGCTGG - Intergenic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1170700084 20:18695651-18695673 AGGAAGAAACAGAAAAAGGGAGG - Intronic
1171158902 20:22903846-22903868 AAGGAAAAACAGATTACTGAAGG - Intergenic
1171771473 20:29325866-29325888 AGCGAGAAACAGAGAAAGGAAGG + Intergenic
1171823917 20:29877894-29877916 AGCAAGAAACAGAGAACGGAAGG - Intergenic
1171896164 20:30812443-30812465 AGCAAGAAACAGAGAACGGAAGG + Intergenic
1172171687 20:32939251-32939273 AGAGAGAGAGAGAATATGGAAGG - Intronic
1172643391 20:36455251-36455273 AGGGAGAAGCAGAGAACTGAGGG - Intronic
1172830605 20:37830981-37831003 AGGGATAAATGGAATACAGATGG - Intronic
1172904864 20:38361810-38361832 ACCGAGAAACAGAACACGGCTGG + Intronic
1174551336 20:51364122-51364144 AGGAAGAAACAGTAAAAGGAAGG + Intergenic
1174945791 20:54983883-54983905 AGAGAGAAACAGAACACGGCAGG + Intergenic
1175052190 20:56166138-56166160 AGACAGAAACAGGATAAGGAAGG + Intergenic
1175580654 20:60096278-60096300 AGGGAGCAACAGCATTCGCATGG - Intergenic
1176617802 21:9037653-9037675 ATGGATAAACAGTTTACGGATGG + Intergenic
1176704552 21:10102550-10102572 AGGAAGAAACATAATATGAAAGG + Intergenic
1177375953 21:20271118-20271140 AGGGAGGAACAGAACAGGGCAGG - Intergenic
1177535671 21:22423788-22423810 AGGGAGAGAAAGAACATGGAAGG + Intergenic
1177701003 21:24639143-24639165 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1178256263 21:31055190-31055212 AGAGACAAACAGAAAAAGGAAGG + Intergenic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178735607 21:35147199-35147221 AGGGAGAAAGATATTAAGGATGG - Intronic
1179071212 21:38072789-38072811 AGGGAGAAATGGACTATGGAGGG + Intronic
1179073159 21:38092058-38092080 AGGGAGGGACAGAAGACAGAAGG - Intronic
1179678866 21:43003646-43003668 AGGGAGAGACACAATACACAGGG - Intronic
1181079575 22:20405166-20405188 AGGGAGAGGAAGAACACGGAAGG - Intronic
1181647387 22:24240287-24240309 AAGAAGAAACAGAATAGGCATGG + Intronic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183533731 22:38381707-38381729 AAAGAGAAACAGACTACAGAGGG - Intronic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
949474103 3:4426135-4426157 AGGGGTAAACAGAATACAGGAGG + Intronic
949519594 3:4837687-4837709 GGGCAGAAACAGAGTACGCACGG - Intronic
949916108 3:8965850-8965872 AGGAAGAAAAAAAATAAGGAAGG - Intergenic
950472640 3:13196088-13196110 AGAGAGAAAGAGAAGAGGGAGGG - Intergenic
952108503 3:30095971-30095993 AGGGAGAAACAGAGGAAGGGAGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952734459 3:36674988-36675010 AGAGAGAAACAGAACAGGGCAGG - Intergenic
953008892 3:39005087-39005109 AGAGAGAAACAGAACAGGGCAGG + Intergenic
953120547 3:40037044-40037066 AGGAAGAAACAGAAAAGGCATGG + Intronic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
954543095 3:51409116-51409138 AGGGAGAAAGAGATTAGGAAGGG - Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
956996402 3:74831066-74831088 AGAGAGAAACAGAACAGGAAAGG - Intergenic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958532883 3:95357060-95357082 AGAGAGAAACAGAACAGGGCAGG - Intergenic
958541017 3:95472245-95472267 AGGGAGAAAAATAAAACAGAAGG + Intergenic
958790142 3:98642956-98642978 AGAGAGAAACAGAACAGGGCAGG + Intergenic
959432947 3:106277479-106277501 AGGGAGCCATAGAATACAGAAGG + Intergenic
959711865 3:109393666-109393688 AGAGAGAAACAGAACAGGGCAGG - Intergenic
959970795 3:112407333-112407355 AGAGAGAAACAGAACAGGGCAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960208010 3:114926500-114926522 ACAGAGAAACAGAAAACAGAAGG + Intronic
960456625 3:117880469-117880491 AGGGAGAAAGGGCATAAGGAAGG - Intergenic
960641517 3:119828650-119828672 AGGGAGACACAGAATATCCAAGG + Intronic
961047632 3:123720406-123720428 AGGGAGTATCAGAAAACAGAGGG + Intronic
961260394 3:125596963-125596985 AGAGAGAAACAGAACAGGGCAGG - Intergenic
962757570 3:138477857-138477879 AGGCAGAGACAGAAAACTGACGG - Exonic
962769325 3:138597642-138597664 AGAGAGAAACAGAACAGGGCAGG + Intergenic
963768218 3:149361088-149361110 ACAGAGAAAAAGAATAAGGAGGG - Intergenic
963840677 3:150102695-150102717 AGGAAGGAAAAGAATAAGGAAGG - Intergenic
964271734 3:154964008-154964030 AGGGAGAGAAAGAAGATGGAGGG - Intergenic
967214584 3:187199510-187199532 AGGGAGGAATAGAAGACGGGCGG - Intronic
967391607 3:188961708-188961730 AGGAGGAAACAGAACAAGGAAGG - Intronic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967659709 3:192091642-192091664 AGAGAGAAACAGAACAGGGCAGG + Intergenic
968378732 4:69620-69642 AGGAACAACCAGAATACGTAAGG - Intronic
969321827 4:6417219-6417241 AGGGAGTAAGAGAAAAGGGAAGG + Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970353534 4:15229835-15229857 AGAGAGAAAAAGAAGACAGAGGG + Intergenic
970385512 4:15552498-15552520 AAGGAGAAACAAATTAGGGAAGG - Intronic
970997132 4:22280460-22280482 AGGGCGAAAGAGAACATGGAGGG + Intergenic
971130671 4:23806063-23806085 GGGGAGAAACAGGAAACCGAAGG + Intronic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971782673 4:31056699-31056721 AGAGAGAAAGAGAAAAAGGAAGG + Intronic
972515470 4:39807078-39807100 AGAGAGAAAAAGAAAAAGGAAGG + Intergenic
973104396 4:46315825-46315847 AGGGATAAACAGAAGAGGAAGGG - Intronic
973291167 4:48472198-48472220 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
973557135 4:52094947-52094969 AGGCAGACACAGAAGACAGATGG - Exonic
974317609 4:60302858-60302880 AGGTGGAAAGAGAATAAGGAAGG + Intergenic
974949444 4:68570302-68570324 AGAGAGAAACAGAACAGGGCAGG + Intronic
974950035 4:68576444-68576466 AGAGAGAAACAGAACAGGGCAGG + Intronic
974987764 4:69051089-69051111 AGAGAGAAACAGAACAGGGCAGG - Intronic
974988342 4:69057088-69057110 AGAGAGAAACAGAACAGGGCAGG - Intronic
976361899 4:84189518-84189540 ACTGAAAAACAGAATACAGATGG + Intergenic
976989912 4:91353344-91353366 AGAGAGAAACAGAACAGGGCAGG + Intronic
977135697 4:93300890-93300912 AGAGAGAAACAGAACAGGGCAGG + Intronic
977919236 4:102625306-102625328 AGAGAGAAAGAGAAAGCGGAGGG - Intergenic
978627921 4:110708486-110708508 AGGAAGAAACAGAAAAAGGCTGG - Intergenic
979724169 4:123940914-123940936 AAGGAGAAAGAGAAGACAGATGG + Intergenic
980376759 4:131958883-131958905 AGGAAGAAACATAATATGAAAGG + Intergenic
980725763 4:136758330-136758352 AGGGAGAAACAGGTTAGAGAGGG + Intergenic
981014264 4:139957142-139957164 AGGAAGAAACAGAAAACGGAAGG + Intronic
981046109 4:140266821-140266843 AGGGAGAAAGAGAAAAAGTAAGG + Intronic
981409782 4:144416215-144416237 AGAGAAAAACAGAATAAAGAAGG + Intergenic
982121472 4:152147510-152147532 AGGGAGTGAAAGAATAGGGAGGG + Intergenic
982473304 4:155820313-155820335 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
983245216 4:165279869-165279891 CAGGAGAAACAAAATACGCAGGG - Intronic
983449918 4:167896285-167896307 AGAGAGAAACAGAACAGGGCAGG + Intergenic
984193723 4:176634034-176634056 AGGCAGACACAGAAGACTGAAGG + Intergenic
984751124 4:183276376-183276398 AGGAAGAAAAAGAATAAAGATGG - Intronic
985165212 4:187086795-187086817 AGAAAGAAATAGAAAACGGAAGG - Intergenic
985399686 4:189582210-189582232 AGTGCGAAACAGTTTACGGAAGG + Intergenic
985936021 5:3099096-3099118 AGTGAGAAAAAGAAGAGGGAGGG - Intergenic
985955849 5:3265864-3265886 AGGAAGCAACAGAATACCAAAGG + Intergenic
986587128 5:9330128-9330150 AGGGAAAAAAAAAATACAGATGG + Intronic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987855886 5:23420312-23420334 AGAGAGAAACAGAACAGGGCAGG + Intergenic
988287576 5:29240108-29240130 AGAGAGAAACAGAACAGGGCAGG + Intergenic
988376159 5:30438837-30438859 AAAGAGAAACTGAAGACGGAAGG + Intergenic
989557374 5:42813399-42813421 AGAGAGAAACAGAACAGGGCAGG - Intronic
989981922 5:50655684-50655706 AGAGAGAAAAAGAAGAAGGAAGG - Intergenic
990315807 5:54582194-54582216 AGAGAAAAACAGATTACGGTTGG + Intergenic
990446133 5:55896437-55896459 AGAGAGAAAAAGAATCCAGAGGG - Intronic
991000261 5:61775655-61775677 ATGGAGACACGGAAGACGGAGGG + Intergenic
991032326 5:62095617-62095639 AGGGAGAAACAGAGAAGGGAAGG + Intergenic
991202202 5:64007515-64007537 AGAGAGAAAGAGAATACATATGG - Intergenic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992027443 5:72684609-72684631 AGTGAGAAACAAAAGATGGAAGG - Intergenic
992308920 5:75474157-75474179 AGAGAGAAACAGAACAGGGCAGG - Intronic
993814619 5:92527300-92527322 AGAAAGAAACAGAATACGTCTGG + Intergenic
994864862 5:105255009-105255031 AGAGAGAAACAGAGGATGGAAGG + Intergenic
996128726 5:119755124-119755146 AGAGAGAAACAGAACAGGGCAGG - Intergenic
996854974 5:127995512-127995534 TGACAGAAACAGAATACTGATGG + Intergenic
997318992 5:132962999-132963021 AAGGAGAAACACTAAACGGATGG + Intronic
998115123 5:139531318-139531340 AGAGAGAAACAGAACAGGGCAGG - Intronic
998231110 5:140361980-140362002 AAGGAGACACAGAATATGAAAGG - Intronic
998333172 5:141347118-141347140 AGAGAGAAACAGAGGAAGGAAGG - Intronic
998939349 5:147263764-147263786 AGAGAGAAAGAGAAAATGGAAGG + Intronic
999147482 5:149405900-149405922 AGGGTGTGACAGAATACTGAGGG + Intergenic
999184750 5:149698801-149698823 AGGGAGGAAGAAAAGACGGAAGG + Intergenic
1000605117 5:163319272-163319294 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001349877 5:170950336-170950358 AGGGAGGAATAGAATATGCAAGG + Intronic
1002585597 5:180245035-180245057 AGGGACAAAGGGAATAGGGAAGG - Intronic
1005149817 6:22735994-22736016 AGGGAGGAAGAGAAGACGGAAGG - Intergenic
1005472753 6:26178052-26178074 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1005562245 6:27052545-27052567 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1006032365 6:31186519-31186541 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1007024983 6:38562260-38562282 AGGAAGAAACTGAAGAGGGAAGG - Intronic
1007054855 6:38872624-38872646 AGGCGCAAACAGAATGCGGAAGG + Exonic
1007865317 6:44962876-44962898 AGGGAGACAGAAAATAAGGAAGG - Intronic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1009357281 6:62766418-62766440 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1010317557 6:74468372-74468394 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1011085625 6:83537435-83537457 AGAGAGAAAAAGAAAAGGGAGGG - Intergenic
1011458150 6:87574571-87574593 AGGGAGAGAGAGAATAGGGAGGG + Intronic
1011770029 6:90665442-90665464 AGGGAGAAAGAGAGAAAGGAAGG - Intergenic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1012849019 6:104424551-104424573 AGGGAAACATAGAACACGGAAGG - Intergenic
1013376925 6:109526413-109526435 ACAGAGAAACAGAAAACAGAGGG + Intronic
1013558868 6:111284399-111284421 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1013559507 6:111290373-111290395 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1013787913 6:113802950-113802972 AGAGAGAAAGAGAAAAAGGAAGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1016131997 6:140485484-140485506 AGGGAAAAACAGATCATGGATGG - Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1017226139 6:152022991-152023013 AGAGAGAAAAAGAAAAAGGATGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1018091528 6:160349653-160349675 ATGCAGAAACAGATTACTGAGGG - Intronic
1018769529 6:166958507-166958529 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1018771257 6:166973275-166973297 AGGCACAAACAAAATAAGGAAGG + Intergenic
1020415465 7:7940961-7940983 AGGTAGAAGCAGAAGACTGAAGG - Intronic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021081324 7:16369308-16369330 AGAGAGAAACAGAACAGGGCAGG + Intronic
1021169605 7:17382827-17382849 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1022337819 7:29438754-29438776 AGGGAGATACAAAATATGAAGGG - Intronic
1022445832 7:30469944-30469966 GGGGAGAAACAGAGTAAGGTGGG - Intronic
1023466756 7:40464448-40464470 AGGGACAAACAGAATTAGGCAGG + Intronic
1024400023 7:48913596-48913618 AGAGAGAGAGAGAATACGGGAGG - Intergenic
1026319269 7:69254802-69254824 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
1026748291 7:73029714-73029736 AGGCACAAACTGAATGCGGAAGG + Intergenic
1026751939 7:73057859-73057881 AGGCACAAACTGAATGCGGAAGG + Intergenic
1026755588 7:73085986-73086008 AGGCACAAACTGAATGCGGAAGG + Intergenic
1027034493 7:74915026-74915048 AGGCATAAACTGAATGCGGAAGG + Intergenic
1027091812 7:75307406-75307428 AGGCACAAACTGAATGCGGAAGG - Intergenic
1027095455 7:75335373-75335395 AGGCACAAACTGAATGCGGAAGG - Intergenic
1027323886 7:77032309-77032331 AGGCACAAACTGAATGCGGAAGG + Intergenic
1027350263 7:77304882-77304904 AGAGAGAAACAGAACAGGGCAGG + Intronic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028842039 7:95439137-95439159 AGGGATAAAAGGAATATGGAGGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029449412 7:100632528-100632550 AGAGAGAAACAGAGAAGGGAGGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030731081 7:112990161-112990183 AGAGAGAAACTGAATATTGATGG - Intergenic
1031257039 7:119466402-119466424 AGGGAGGAAGAGAATATGAAAGG - Intergenic
1032782088 7:135171492-135171514 AGGGAGAAACAGAACAGGGCAGG - Intergenic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1033713189 7:143971113-143971135 AGGAAGAAAAATAATAAGGAAGG + Intergenic
1034527298 7:151673411-151673433 AGGGAGAAACGGAAAACCGCTGG - Intronic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1036929185 8:12936638-12936660 AGGGAAAAAGAATATACGGAGGG + Intergenic
1037066505 8:14584871-14584893 AGAAAGAAACAGAATATGTAAGG + Intronic
1037419248 8:18684454-18684476 AGGAAGAAAAAAAATATGGATGG + Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038131033 8:24731903-24731925 AGGGAGAAAAAAAATAGGGTAGG + Intergenic
1039328716 8:36513404-36513426 AGGTCTAAACAGAATAGGGAAGG - Intergenic
1040021063 8:42741742-42741764 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1042355683 8:67824955-67824977 AGAGAGAAACAGAACACGGCAGG - Intergenic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043391018 8:79791763-79791785 AGAGAGATAAAGAATATGGAAGG - Intergenic
1043551985 8:81384955-81384977 AAGGAGAAATAAAATACTGAGGG - Intergenic
1044111388 8:88279703-88279725 ATGGAAAAACAAAATATGGAGGG + Intronic
1044142760 8:88675108-88675130 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045085991 8:98686240-98686262 AGGGAGTAAAAGAATACAGAAGG + Intronic
1045834131 8:106500410-106500432 AGAGAGAAACAGAACAGGGCAGG - Intronic
1046266561 8:111837858-111837880 AGGGAGAAAAGAAATACGAAAGG + Intergenic
1046725102 8:117665579-117665601 TGGGAGAGACAGAAGACTGAGGG + Intergenic
1047099612 8:121662281-121662303 AGGGAGAAAATGAATTCTGATGG + Intergenic
1047231627 8:123002536-123002558 TGGGGGACACAGAATACGCAAGG - Intergenic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1048915498 8:139178927-139178949 AGGGAGAAACAGAACAGGGCAGG + Intergenic
1049034978 8:140068270-140068292 AGGGATGAAGAGAATACAGAAGG + Intronic
1050138495 9:2493455-2493477 AGAGAGAAACACAAAAGGGAGGG + Intergenic
1050938758 9:11431755-11431777 AGGGAGAAAAAGAAAAAGAAGGG + Intergenic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052275457 9:26670702-26670724 AGGGAGTAACAAAGTAGGGAAGG - Intergenic
1052357907 9:27524990-27525012 AAGGAGAAAGAGATTTCGGAGGG - Intronic
1052661875 9:31443937-31443959 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053641808 9:40089566-40089588 AGGAAGAAACATAATATGAAAGG + Intergenic
1053764328 9:41375898-41375920 AGGAAGAAACATAATATGAAAGG - Intergenic
1054322698 9:63686955-63686977 AGGAAGAAACATAATATGAAAGG + Intergenic
1054542943 9:66287076-66287098 AGGAAGAAACATAATATGAAAGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1055264631 9:74480879-74480901 AGGAAGAAGCAGAAGACAGAGGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059082312 9:111263299-111263321 AAGGAGAGACAGAAAACAGAGGG + Intergenic
1059758505 9:117316640-117316662 AGGCAGAAACACAATTCTGAGGG - Intronic
1060165716 9:121412849-121412871 AGGGAGAGACAGAGGAGGGAGGG - Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060318916 9:122537229-122537251 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1060340856 9:122775844-122775866 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1061035711 9:128113320-128113342 GGGGAGAAAGAGAAGATGGATGG - Intergenic
1061575902 9:131505858-131505880 AGGGAGAGACAGAATCTGTATGG + Intronic
1061688086 9:132300226-132300248 AGGGAGAAACATACAACGGATGG + Intronic
1061805622 9:133136222-133136244 AGGCAAAAACAGAACAGGGAAGG + Intronic
1202789586 9_KI270719v1_random:72642-72664 AGGAAGAAACATAATATGAAAGG + Intergenic
1203654033 Un_KI270752v1:6531-6553 AGGGAGAAAGTGAATAAGGATGG - Intergenic
1185492335 X:527210-527232 AGGAAGAAAAGGAATAAGGAAGG - Intergenic
1185492473 X:528487-528509 AGGAAGAAAAGGAATAAGGAAGG - Intergenic
1185602326 X:1348878-1348900 AGGGAGGAAAAGAAAACGAAAGG - Intronic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185895956 X:3859134-3859156 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1185901075 X:3897558-3897580 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1185906189 X:3935997-3936019 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1186013361 X:5163138-5163160 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1186896167 X:14006453-14006475 AGGGAGAAAAAAAATCCTGAGGG + Intergenic
1187560098 X:20394610-20394632 AGGGAAAAGTAGAAAACGGAAGG + Intergenic
1188432841 X:30125685-30125707 TGGCAGAAACAGAATAATGAGGG + Intergenic
1188897929 X:35693523-35693545 AGGGAGGAACAGAACAGGGCAGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190296047 X:49028633-49028655 TGGGAGAAACAGATTCCAGAAGG - Intergenic
1190583758 X:51916418-51916440 AGAGAGAAACAAAAAACAGAGGG - Intergenic
1190639785 X:52473145-52473167 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1192074990 X:67985019-67985041 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1193156513 X:78180072-78180094 ATGGAGAACCAGAATATGTAGGG - Intergenic
1193186059 X:78514102-78514124 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1193538823 X:82745990-82746012 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1193696525 X:84713378-84713400 AGGGAGATACAGGAGAGGGAAGG - Intergenic
1193791332 X:85818860-85818882 TGGGAGAAACAAAAAAGGGATGG + Intergenic
1194318963 X:92419632-92419654 AGAGAGAAACAGAAAAGAGAAGG - Intronic
1195170182 X:102259767-102259789 AGGAAGAGACAGAATATGAAAGG - Intergenic
1195188675 X:102427333-102427355 AGGAAGAGACAGAATATGAAAGG + Intronic
1195801492 X:108716697-108716719 AGGGAGAATCATAACAGGGAGGG + Intergenic
1195901234 X:109799862-109799884 AGGGAGAAACAATACCCGGATGG + Intergenic
1196252094 X:113473162-113473184 AGAGAGAAACAGAAGAGGGCAGG + Intergenic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1197114240 X:122813726-122813748 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1198527707 X:137518778-137518800 AGGGAGAAACAGCATAAGCGAGG + Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1199162850 X:144634614-144634636 AGAGAGAAACAGAACAGGGCAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199435114 X:147804457-147804479 AGAGAGAAAGAGAAGAGGGAAGG + Intergenic
1199903383 X:152199775-152199797 AGAGAGCAACAGAACACGGTGGG - Intronic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200627093 Y:5532792-5532814 AGAGAGAAACAGAAAAGGGAAGG - Intronic
1201336413 Y:12885543-12885565 AGGCAGAAACAGAAAATTGAAGG - Intergenic
1201372676 Y:13282526-13282548 AGAGAGAAACAGAACAAGGCAGG - Intronic
1201373357 Y:13289470-13289492 AGAGAGAAACAGAACAAGGCAGG - Intronic
1201390683 Y:13493853-13493875 AGAGAGAAACAGAACAGGGCAGG + Intergenic
1201458923 Y:14201313-14201335 AGGGAGGAAGAAAATAAGGAAGG + Intergenic
1202593715 Y:26514311-26514333 AAAGAGAAACAGACTACAGAAGG + Intergenic